Incidental Mutation 'R2016:Spata5'
ID 222976
Institutional Source Beutler Lab
Gene Symbol Spata5
Ensembl Gene ENSMUSG00000027722
Gene Name spermatogenesis associated 5
Synonyms C78064, 2510048F20Rik, Spaf
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2016 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 37419896-37579096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37578762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 839 (V839A)
Ref Sequence ENSEMBL: ENSMUSP00000103747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029277] [ENSMUST00000108112] [ENSMUST00000198968]
AlphaFold Q3UMC0
Predicted Effect probably benign
Transcript: ENSMUST00000029277
AA Change: V838A

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029277
Gene: ENSMUSG00000027722
AA Change: V838A

low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 135 2.47e-1 SMART
low complexity region 276 287 N/A INTRINSIC
AAA 385 524 4.96e-21 SMART
Blast:AAA 553 622 9e-21 BLAST
AAA 659 797 2.48e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108112
AA Change: V839A

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103747
Gene: ENSMUSG00000027722
AA Change: V839A

low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 1.14e0 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 4.96e-21 SMART
Blast:AAA 554 623 9e-21 BLAST
AAA 660 798 2.48e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132958
Predicted Effect probably benign
Transcript: ENSMUST00000198968
SMART Domains Protein: ENSMUSP00000143349
Gene: ENSMUSG00000027722

low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 8.6e-5 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 8.2e-23 SMART
Blast:AAA 554 623 7e-21 BLAST
AAA 660 798 4e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200093
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATPase associated with diverse activities family, whose members are defined by a highly conserved ATPase domain. Members of this family participate in diverse cellular processes that include membrane fusion, DNA replication, microtubule severing, and protein degradation. The protein encoded by this gene has a putative mitochondrial targeting sequence and has been proposed to function in maintenance of mitochondrial function and integrity during mouse spermatogenesis. Allelic variants in this gene have been associated with epilepsy, hearing loss, and mental retardation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Spata5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Spata5 APN 3 37451802 missense possibly damaging 0.60
IGL00472:Spata5 APN 3 37436644 missense probably benign
IGL02664:Spata5 APN 3 37436665 missense probably damaging 1.00
IGL02797:Spata5 APN 3 37458316 splice site probably benign
IGL02869:Spata5 APN 3 37464545 missense probably damaging 1.00
IGL02891:Spata5 APN 3 37426192 missense probably damaging 0.97
IGL03065:Spata5 APN 3 37432179 missense possibly damaging 0.75
IGL03121:Spata5 APN 3 37464651 missense probably damaging 1.00
IGL03178:Spata5 APN 3 37578783 missense probably damaging 1.00
R0494:Spata5 UTSW 3 37432163 missense possibly damaging 0.79
R0621:Spata5 UTSW 3 37432029 missense probably benign 0.06
R0908:Spata5 UTSW 3 37431623 splice site probably null
R1773:Spata5 UTSW 3 37439185 missense probably damaging 0.99
R3714:Spata5 UTSW 3 37433209 missense probably benign
R3836:Spata5 UTSW 3 37433643 missense possibly damaging 0.91
R4548:Spata5 UTSW 3 37432027 missense probably benign 0.03
R4695:Spata5 UTSW 3 37458325 missense probably damaging 1.00
R4758:Spata5 UTSW 3 37433236 missense probably benign 0.01
R5009:Spata5 UTSW 3 37433277 splice site probably benign
R5839:Spata5 UTSW 3 37464654 missense probably damaging 1.00
R6437:Spata5 UTSW 3 37528198 missense probably damaging 1.00
R7067:Spata5 UTSW 3 37431698 nonsense probably null
R7450:Spata5 UTSW 3 37456785 missense probably damaging 1.00
R7889:Spata5 UTSW 3 37578810 missense probably benign 0.01
R7898:Spata5 UTSW 3 37420471 missense probably benign 0.04
R8108:Spata5 UTSW 3 37431782 missense probably benign 0.25
R8511:Spata5 UTSW 3 37436748 missense probably damaging 0.99
R8870:Spata5 UTSW 3 37448512 missense probably benign 0.35
R8941:Spata5 UTSW 3 37431993 missense probably damaging 0.97
R9475:Spata5 UTSW 3 37431909 missense probably benign
Z1176:Spata5 UTSW 3 37431750 missense possibly damaging 0.67
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-08-25