Incidental Mutation 'R2016:Lrif1'
Institutional Source Beutler Lab
Gene Symbol Lrif1
Ensembl Gene ENSMUSG00000056260
Gene Nameligand dependent nuclear receptor interacting factor 1
Synonyms2010012G17Rik, 4933421E11Rik
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosomal Location106684987-106736577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106732206 bp
Amino Acid Change Leucine to Phenylalanine at position 202 (L202F)
Ref Sequence ENSEMBL: ENSMUSP00000096346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098750] [ENSMUST00000098751] [ENSMUST00000106736] [ENSMUST00000127003] [ENSMUST00000130105] [ENSMUST00000150513] [ENSMUST00000154973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098750
AA Change: L202F

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096346
Gene: ENSMUSG00000056260
AA Change: L202F

Pfam:LRIF1 22 753 1.7e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098751
SMART Domains Protein: ENSMUSP00000096347
Gene: ENSMUSG00000056260

low complexity region 104 117 N/A INTRINSIC
coiled coil region 225 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106736
SMART Domains Protein: ENSMUSP00000102347
Gene: ENSMUSG00000056260

low complexity region 84 97 N/A INTRINSIC
coiled coil region 205 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106737
SMART Domains Protein: ENSMUSP00000102348
Gene: ENSMUSG00000056260

Pfam:LRIF1 22 347 6.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122928
Predicted Effect possibly damaging
Transcript: ENSMUST00000127003
AA Change: L202F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114163
Gene: ENSMUSG00000056260
AA Change: L202F

low complexity region 74 92 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130105
AA Change: L177F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115110
Gene: ENSMUSG00000056260
AA Change: L177F

low complexity region 49 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150513
SMART Domains Protein: ENSMUSP00000119815
Gene: ENSMUSG00000056260

low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150888
Predicted Effect probably benign
Transcript: ENSMUST00000154973
SMART Domains Protein: ENSMUSP00000120350
Gene: ENSMUSG00000056260

low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194058
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Lrif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Lrif1 APN 3 106734641 critical splice donor site probably null
IGL01121:Lrif1 APN 3 106735664 nonsense probably null
IGL01304:Lrif1 APN 3 106731733 missense probably damaging 1.00
IGL02209:Lrif1 APN 3 106731729 missense probably damaging 1.00
IGL02801:Lrif1 APN 3 106734614 missense possibly damaging 0.89
IGL02796:Lrif1 UTSW 3 106735436 missense probably benign 0.25
R0440:Lrif1 UTSW 3 106734398 missense possibly damaging 0.87
R0456:Lrif1 UTSW 3 106731778 missense probably benign 0.06
R0561:Lrif1 UTSW 3 106732165 missense probably damaging 1.00
R1160:Lrif1 UTSW 3 106732717 missense possibly damaging 0.95
R1720:Lrif1 UTSW 3 106733136 missense probably damaging 1.00
R1735:Lrif1 UTSW 3 106735846 makesense probably null
R1843:Lrif1 UTSW 3 106732811 missense probably damaging 0.99
R2200:Lrif1 UTSW 3 106734558 missense probably damaging 0.98
R3619:Lrif1 UTSW 3 106732546 missense probably damaging 1.00
R4750:Lrif1 UTSW 3 106735564 missense probably benign 0.33
R4878:Lrif1 UTSW 3 106735640 missense probably damaging 1.00
R4945:Lrif1 UTSW 3 106735753 missense probably damaging 1.00
R5286:Lrif1 UTSW 3 106732543 missense probably damaging 0.97
R5682:Lrif1 UTSW 3 106732568 missense possibly damaging 0.70
R6149:Lrif1 UTSW 3 106732327 missense possibly damaging 0.83
R6665:Lrif1 UTSW 3 106735343 intron probably null
R7011:Lrif1 UTSW 3 106732285 missense probably damaging 1.00
R7584:Lrif1 UTSW 3 106731901 missense probably benign 0.32
Z1088:Lrif1 UTSW 3 106732570 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25