Incidental Mutation 'R2016:Pds5a'
ID222998
Institutional Source Beutler Lab
Gene Symbol Pds5a
Ensembl Gene ENSMUSG00000029202
Gene NamePDS5 cohesin associated factor A
Synonyms9030416H16Rik, E230024D05Rik
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location65605721-65698273 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 65648007 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000201948]
Predicted Effect probably null
Transcript: ENSMUST00000031104
SMART Domains Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201109
Predicted Effect probably null
Transcript: ENSMUST00000201948
SMART Domains Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Pds5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Pds5a APN 5 65656344 missense probably damaging 1.00
IGL00979:Pds5a APN 5 65631723 missense probably benign 0.22
IGL01314:Pds5a APN 5 65615294 missense probably benign
IGL02449:Pds5a APN 5 65619010 missense probably damaging 1.00
IGL02539:Pds5a APN 5 65666119 missense probably damaging 1.00
IGL03395:Pds5a APN 5 65652449 missense possibly damaging 0.61
R0569:Pds5a UTSW 5 65656401 missense probably damaging 1.00
R0704:Pds5a UTSW 5 65620585 missense probably damaging 1.00
R1170:Pds5a UTSW 5 65635302 splice site probably benign
R1181:Pds5a UTSW 5 65627202 splice site probably null
R1193:Pds5a UTSW 5 65637802 missense probably damaging 1.00
R1537:Pds5a UTSW 5 65647121 missense probably benign 0.09
R1853:Pds5a UTSW 5 65624029 missense possibly damaging 0.56
R2154:Pds5a UTSW 5 65650498 missense probably damaging 1.00
R2209:Pds5a UTSW 5 65628014 nonsense probably null
R2234:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2235:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2332:Pds5a UTSW 5 65627079 splice site probably null
R3114:Pds5a UTSW 5 65618985 missense probably damaging 1.00
R3417:Pds5a UTSW 5 65637892 missense probably damaging 0.99
R3820:Pds5a UTSW 5 65654076 missense possibly damaging 0.94
R4152:Pds5a UTSW 5 65666171 nonsense probably null
R4159:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4160:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4161:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4230:Pds5a UTSW 5 65629986 missense possibly damaging 0.85
R4491:Pds5a UTSW 5 65635437 missense probably benign
R4647:Pds5a UTSW 5 65656318 missense probably damaging 1.00
R4816:Pds5a UTSW 5 65651289 missense probably damaging 1.00
R4867:Pds5a UTSW 5 65644120 missense probably damaging 1.00
R5001:Pds5a UTSW 5 65696785 missense probably damaging 0.99
R5013:Pds5a UTSW 5 65635337 missense probably benign 0.05
R5054:Pds5a UTSW 5 65637814 missense probably damaging 1.00
R5068:Pds5a UTSW 5 65615272 missense probably damaging 0.99
R5178:Pds5a UTSW 5 65663875 missense probably damaging 1.00
R5269:Pds5a UTSW 5 65663928 missense probably damaging 1.00
R5396:Pds5a UTSW 5 65638577 missense probably benign 0.09
R5704:Pds5a UTSW 5 65627079 splice site probably null
R5940:Pds5a UTSW 5 65643985 intron probably benign
R6306:Pds5a UTSW 5 65656296 missense probably damaging 1.00
R6322:Pds5a UTSW 5 65696834 missense probably benign 0.00
R6467:Pds5a UTSW 5 65652439 missense probably damaging 1.00
R6476:Pds5a UTSW 5 65634287 missense possibly damaging 0.94
R6513:Pds5a UTSW 5 65615601 missense probably benign 0.18
R7304:Pds5a UTSW 5 65619734 missense probably damaging 1.00
R7312:Pds5a UTSW 5 65666227 missense possibly damaging 0.81
R7438:Pds5a UTSW 5 65652535 critical splice acceptor site probably null
R7637:Pds5a UTSW 5 65638604 missense probably benign 0.12
R7654:Pds5a UTSW 5 65618981 missense probably damaging 1.00
R7707:Pds5a UTSW 5 65610133 missense unknown
R7715:Pds5a UTSW 5 65638561 missense possibly damaging 0.96
Z1088:Pds5a UTSW 5 65618986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATTTCTAGACCAGTTTGAGC -3'
(R):5'- TTGATAAAATGCCCTCCTAACATGC -3'

Sequencing Primer
(F):5'- AGGAAATTTAGCTCTGAAAACAGC -3'
(R):5'- ATAAAGTCAGGTGTGGTGGCTCAC -3'
Posted On2014-08-25