Incidental Mutation 'R2016:Prkcg'
List |< first << previous [record 62 of 83] next >> last >|
ID223006
Institutional Source Beutler Lab
Gene Symbol Prkcg
Ensembl Gene ENSMUSG00000078816
Gene Nameprotein kinase C, gamma
SynonymsPrkcc, PKCgamma, Pkcc
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3289179-3331099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3323550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 460 (T460S)
Ref Sequence ENSEMBL: ENSMUSP00000131351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100301] [ENSMUST00000172109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100301
AA Change: T511S

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097874
Gene: ENSMUSG00000078816
AA Change: T511S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
low complexity region 319 331 N/A INTRINSIC
S_TKc 351 614 1.37e-94 SMART
S_TK_X 615 677 1.77e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172109
AA Change: T460S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131351
Gene: ENSMUSG00000078816
AA Change: T460S

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
C1 36 85 2.89e-16 SMART
C1 101 150 2.27e-14 SMART
C2 172 275 1.35e-26 SMART
S_TKc 309 563 2.73e-80 SMART
S_TK_X 564 626 1.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203081
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Depending upon genetic background, homozygous null mice show mild deficits in spatial learning and contextual conditioning. Genotype-dependent reductions in sensitivity to the effects of ethanol on righting reflex and hypothermia, in neuropathic pain after injury, and in anxiety are also evident. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Prkcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Prkcg APN 7 3319619 missense probably benign 0.27
IGL01551:Prkcg APN 7 3303826 unclassified probably benign
IGL02167:Prkcg APN 7 3322581 critical splice donor site probably null
IGL02434:Prkcg APN 7 3318890 missense probably benign
R0044:Prkcg UTSW 7 3315001 intron probably benign
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0164:Prkcg UTSW 7 3329119 missense probably damaging 1.00
R0413:Prkcg UTSW 7 3319579 missense probably benign 0.00
R0417:Prkcg UTSW 7 3304304 critical splice acceptor site probably null
R1113:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1170:Prkcg UTSW 7 3319661 missense probably damaging 0.97
R1308:Prkcg UTSW 7 3329106 missense probably damaging 1.00
R1634:Prkcg UTSW 7 3323470 missense probably damaging 1.00
R1978:Prkcg UTSW 7 3305346 missense probably damaging 1.00
R2209:Prkcg UTSW 7 3303581 unclassified probably benign
R3788:Prkcg UTSW 7 3313747 missense probably damaging 0.99
R4006:Prkcg UTSW 7 3327467 missense probably damaging 0.96
R4853:Prkcg UTSW 7 3318953 missense probably damaging 0.99
R4915:Prkcg UTSW 7 3330265 nonsense probably null
R4916:Prkcg UTSW 7 3330265 nonsense probably null
R4997:Prkcg UTSW 7 3322581 critical splice donor site probably null
R5446:Prkcg UTSW 7 3330264 missense probably benign 0.00
R5646:Prkcg UTSW 7 3329081 missense probably damaging 0.97
R5677:Prkcg UTSW 7 3323458 missense probably damaging 1.00
R6913:Prkcg UTSW 7 3313819 missense probably benign 0.02
R7355:Prkcg UTSW 7 3323509 missense possibly damaging 0.94
R7371:Prkcg UTSW 7 3319553 missense probably benign 0.27
R7544:Prkcg UTSW 7 3310565 missense probably benign 0.00
R7649:Prkcg UTSW 7 3329964 missense probably benign 0.09
R7742:Prkcg UTSW 7 3329943 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCTAGTGCTCAGATTACAAAATCC -3'
(R):5'- TCAGCATATCAGCCTCCCTG -3'

Sequencing Primer
(F):5'- AGTAGACTAGGTCTGCCTACC -3'
(R):5'- GCATATCAGCCTCCCTGGTCAG -3'
Posted On2014-08-25