Incidental Mutation 'R0141:Tsc22d2'
ID22304
Institutional Source Beutler Lab
Gene Symbol Tsc22d2
Ensembl Gene ENSMUSG00000027806
Gene NameTSC22 domain family, member 2
Synonyms
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R0141 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location58414715-58466783 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 58417156 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000099090] [ENSMUST00000199164]
Predicted Effect unknown
Transcript: ENSMUST00000099090
AA Change: T490S
SMART Domains Protein: ENSMUSP00000096688
Gene: ENSMUSG00000027806
AA Change: T490S

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 683 739 4.1e-29 PFAM
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196049
Predicted Effect unknown
Transcript: ENSMUST00000199164
AA Change: T490S
SMART Domains Protein: ENSMUSP00000143364
Gene: ENSMUSG00000027806
AA Change: T490S

DomainStartEndE-ValueType
low complexity region 95 145 N/A INTRINSIC
low complexity region 204 223 N/A INTRINSIC
low complexity region 253 286 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 377 400 N/A INTRINSIC
low complexity region 426 439 N/A INTRINSIC
low complexity region 441 457 N/A INTRINSIC
low complexity region 459 521 N/A INTRINSIC
low complexity region 531 541 N/A INTRINSIC
Pfam:TSC22 659 718 1.2e-28 PFAM
low complexity region 722 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199784
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cpt1c A G 7: 44,966,671 Y306H probably damaging Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fer1l6 A G 15: 58,558,402 E226G probably damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Lhx9 A G 1: 138,840,006 Y73H possibly damaging Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nr3c2 T A 8: 76,908,408 V46D probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Osbp T C 19: 11,973,859 V256A possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Tsc22d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tsc22d2 APN 3 58417415 unclassified probably benign
IGL01389:Tsc22d2 APN 3 58416238 missense probably damaging 0.98
IGL01407:Tsc22d2 APN 3 58416503 missense probably damaging 0.99
IGL02193:Tsc22d2 APN 3 58460207 utr 3 prime probably benign
IGL02641:Tsc22d2 APN 3 58416155 missense probably damaging 1.00
IGL02956:Tsc22d2 APN 3 58417546 missense unknown
R0421:Tsc22d2 UTSW 3 58417328 unclassified probably benign
R1743:Tsc22d2 UTSW 3 58417539 frame shift probably null
R2214:Tsc22d2 UTSW 3 58416206 missense probably damaging 1.00
R5155:Tsc22d2 UTSW 3 58417316 unclassified probably benign
R5242:Tsc22d2 UTSW 3 58415939 missense possibly damaging 0.86
R5616:Tsc22d2 UTSW 3 58417162 unclassified probably benign
R6119:Tsc22d2 UTSW 3 58460253 utr 3 prime probably benign
R6454:Tsc22d2 UTSW 3 58415840 missense possibly damaging 0.92
R6855:Tsc22d2 UTSW 3 58416814 missense probably damaging 0.99
R6885:Tsc22d2 UTSW 3 58416208 missense probably damaging 1.00
R7148:Tsc22d2 UTSW 3 58417008 nonsense probably null
R7243:Tsc22d2 UTSW 3 58416463 missense unknown
R8078:Tsc22d2 UTSW 3 58416032 missense probably benign 0.04
R8309:Tsc22d2 UTSW 3 58417123 missense unknown
R8789:Tsc22d2 UTSW 3 58460017 nonsense probably null
Z1176:Tsc22d2 UTSW 3 58417024 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGTTGCCGATGCAGCCATCC -3'
(R):5'- TCGTCAACTTGCCCGACTAAAGG -3'

Sequencing Primer
(F):5'- AGCCCTTGTCTACCAGCG -3'
(R):5'- CTAAGGGTGAACCAACTTGCTG -3'
Posted On2013-04-16