Incidental Mutation 'R2016:Stat6'
ID223056
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Namesignal transducer and activator of transcription 6
Synonyms
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127642986-127660957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127650796 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 147 (L147P)
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092074] [ENSMUST00000120279]
Predicted Effect probably damaging
Transcript: ENSMUST00000092074
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: L147P

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120279
SMART Domains Protein: ENSMUSP00000112722
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
Pfam:STAT_int 2 109 2.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128072
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127654932 missense probably damaging 1.00
IGL01785:Stat6 APN 10 127657227 missense probably damaging 1.00
IGL02939:Stat6 APN 10 127646940 missense probably benign 0.05
IGL03266:Stat6 APN 10 127657155 missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127658205 missense probably benign 0.00
Rigid UTSW 10 127658702 critical splice donor site probably null
Stationary UTSW 10 127652222 missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127658230 missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127657227 missense probably damaging 0.98
R0581:Stat6 UTSW 10 127648116 missense probably damaging 0.99
R0735:Stat6 UTSW 10 127658241 missense probably damaging 1.00
R1333:Stat6 UTSW 10 127651225 missense possibly damaging 0.62
R1352:Stat6 UTSW 10 127650811 missense probably benign 0.32
R1457:Stat6 UTSW 10 127658245 missense probably damaging 0.98
R1538:Stat6 UTSW 10 127653256 missense probably damaging 1.00
R1696:Stat6 UTSW 10 127653049 missense probably damaging 1.00
R3236:Stat6 UTSW 10 127652222 missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127655379 missense probably damaging 1.00
R4467:Stat6 UTSW 10 127651228 missense probably damaging 1.00
R5346:Stat6 UTSW 10 127652313 missense probably benign 0.44
R5481:Stat6 UTSW 10 127647826 splice site probably null
R5722:Stat6 UTSW 10 127658373 missense probably benign 0.00
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6244:Stat6 UTSW 10 127657712 splice site probably null
R6914:Stat6 UTSW 10 127651262 missense probably damaging 1.00
R6937:Stat6 UTSW 10 127658702 critical splice donor site probably null
R6942:Stat6 UTSW 10 127651262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTTCTGTGGAGGGGTAGAG -3'
(R):5'- TGGACCAGGACCATTGACAG -3'

Sequencing Primer
(F):5'- CTTCTGTGGAGGGGTAGAGGTAAAC -3'
(R):5'- CAGGAGGGTCTATCAAATTCTGC -3'
Posted On2014-08-25