Mutagenetix > Incidental Mutations

Incidental Mutation 'R2016:Stat6'

223056

Institutional Source

Beutler Lab

Gene Symbol

Stat6

Ensembl Gene

ENSMUSG00000002147

Gene Name

signal transducer and activator of transcription 6

Synonyms

MMRRC Submission

040025-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.704) question?

Stock #

R2016 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127642986-127660957 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127650796 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 147 (L147P)

Ref Sequence

ENSEMBL: ENSMUSP00000089708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092074] [ENSMUST00000120279]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092074
AA Change: L147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147
AA Change: L147P

Domain	Start	End	E-Value	Type
STAT_int	2	116	2.76e-31	SMART
Pfam:STAT_bind	273	526	4.4e-87	PFAM
SH2	540	622	1.33e-5	SMART
Pfam:STAT6_C	655	837	1.1e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120279

SMART Domains

Protein: ENSMUSP00000112722
Gene: ENSMUSG00000002147

Domain	Start	End	E-Value	Type
Pfam:STAT_int	2	109	2.7e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128072

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025C18Rik	T	C	2: 165,079,026	D29G	unknown	Het
Abca13	A	T	11: 9,290,619	L827F	probably damaging	Het
Abca8a	A	G	11: 110,070,387	F570L	probably damaging	Het
Adck1	T	A	12: 88,461,092	I493N	probably damaging	Het
Adra2c	T	C	5: 35,280,312	C143R	probably damaging	Het
Akap13	C	T	7: 75,704,531	T1800M	probably damaging	Het
Angpt2	T	C	8: 18,705,731	N240S	probably damaging	Het
Apob	G	A	12: 8,007,751	D2078N	possibly damaging	Het
Atp8b1	T	C	18: 64,540,334	N989S	probably damaging	Het
B3gnt2	T	C	11: 22,836,621	D189G	probably damaging	Het
Bcam	G	A	7: 19,760,349	T374M	probably benign	Het
Blm	T	C	7: 80,505,926	D335G	probably benign	Het
Cbfa2t2	T	C	2: 154,517,807	L264P	probably damaging	Het
Col4a2	T	C	8: 11,445,086	F1515L	probably benign	Het
Csf2ra	T	G	19: 61,226,893	M95L	probably benign	Het
Cyp2c70	T	A	19: 40,164,412	T300S	possibly damaging	Het
Cyp4f15	A	T	17: 32,702,159	H440L	probably damaging	Het
Dcaf1	T	A	9: 106,839,088	D360E	probably benign	Het
Ddr2	T	C	1: 169,984,968	M652V	probably damaging	Het
Dnah2	T	A	11: 69,437,070	I3370F	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Efemp1	G	T	11: 28,921,613	R376L	probably damaging	Het
Efl1	A	C	7: 82,753,709	D673A	probably damaging	Het
Eid1	A	G	2: 125,673,201	M4V	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Emilin3	G	A	2: 160,909,610	R170C	possibly damaging	Het
Erap1	T	C	13: 74,664,151	W362R	probably damaging	Het
Fam208b	A	T	13: 3,576,770	I1060K	probably benign	Het
Fam234a	A	G	17: 26,218,316	F91L	probably benign	Het
Fam71e2	A	T	7: 4,759,398	I244N	probably damaging	Het
Flnc	G	A	6: 29,443,797		probably null	Het
Fsip2	A	G	2: 82,982,732	K3132E	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnl3	A	G	14: 31,016,369		probably null	Het
Has1	A	T	17: 17,848,270	I274N	probably damaging	Het
Itsn1	T	C	16: 91,905,501		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Kif13a	T	C	13: 46,810,799	D475G	probably benign	Het
Klhl20	A	T	1: 161,103,038	M298K	probably damaging	Het
Kynu	G	T	2: 43,604,277	G241*	probably null	Het
Lrif1	G	T	3: 106,732,206	L202F	possibly damaging	Het
Lrp5	T	C	19: 3,610,056	K1003E	probably benign	Het
Mamdc2	T	C	19: 23,334,029	D487G	probably damaging	Het
Mapk8ip1	A	G	2: 92,391,034		probably null	Het
Mettl25	T	A	10: 105,797,306	E425D	probably benign	Het
Midn	G	T	10: 80,150,115	R13L	possibly damaging	Het
Mtmr9	T	C	14: 63,540,264	Y136C	possibly damaging	Het
Mylk	G	A	16: 34,996,817	V61M	probably damaging	Het
Nalcn	T	C	14: 123,594,581		probably null	Het
Nle1	G	T	11: 82,905,547	P166Q	probably damaging	Het
Nr4a3	G	A	4: 48,083,252	C595Y	probably damaging	Het
Olfr1133	C	T	2: 87,646,052	V24M	probably benign	Het
Olfr1288	G	T	2: 111,479,187	M134I	probably benign	Het
Olfr724	A	G	14: 49,960,502	I190T	probably benign	Het
Olfr906	A	T	9: 38,488,013		probably null	Het
Olfr963	A	G	9: 39,669,555	Y166C	probably damaging	Het
Pds5a	T	A	5: 65,648,007		probably null	Het
Pitpnm1	T	C	19: 4,111,873	V955A	probably benign	Het
Plcb1	T	A	2: 135,362,420	I898N	possibly damaging	Het
Plcl2	G	A	17: 50,606,694	V244M	probably damaging	Het
Plk1	A	G	7: 122,162,440	K257R	probably damaging	Het
Prkcg	A	T	7: 3,323,550	T460S	probably damaging	Het
Prl7d1	G	A	13: 27,710,173	H138Y	probably damaging	Het
Prss35	A	G	9: 86,755,512	S112G	probably benign	Het
Ptprj	C	T	2: 90,464,614	V417M	probably damaging	Het
Pwwp2b	A	T	7: 139,256,151	I503F	possibly damaging	Het
Rasgrp2	T	C	19: 6,413,165	V498A	probably benign	Het
Sall1	A	G	8: 89,028,409	V1314A	probably benign	Het
Sema6c	A	G	3: 95,171,234	I549V	probably benign	Het
Slc17a1	A	G	13: 23,878,539	S230G	probably benign	Het
Slc5a4a	T	G	10: 76,153,580	F106V	probably benign	Het
Spata5	T	C	3: 37,578,762	V839A	possibly damaging	Het
Taar7d	T	A	10: 24,027,744	S175T	probably benign	Het
Tmem132b	A	G	5: 125,623,016	Q206R	probably benign	Het
Tmem229a	T	C	6: 24,955,062	D231G	probably benign	Het
Trim66	A	G	7: 109,472,232		probably null	Het
Ttc30a1	A	G	2: 75,981,457	L94P	probably benign	Het
Ttll9	A	T	2: 153,002,294	E374V	probably damaging	Het
Vmn2r69	A	T	7: 85,407,285	D548E	probably damaging	Het
Zcchc2	T	A	1: 106,004,121		probably null	Het
Zfp282	T	A	6: 47,897,787		probably null	Het
Zfp352	A	G	4: 90,225,171	E516G	probably benign	Het

Other mutations in Stat6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Stat6	APN	10	127654932	missense	probably damaging	1.00
IGL01785:Stat6	APN	10	127657227	missense	probably damaging	1.00
IGL02939:Stat6	APN	10	127646940	missense	probably benign	0.05
IGL03266:Stat6	APN	10	127657155	missense	possibly damaging	0.88
IGL03412:Stat6	APN	10	127658205	missense	probably benign	0.00
Rigid	UTSW	10	127658702	critical splice donor site	probably null
Stationary	UTSW	10	127652222	missense	possibly damaging	0.93
PIT4142001:Stat6	UTSW	10	127658230	missense	possibly damaging	0.95
R0165:Stat6	UTSW	10	127657227	missense	probably damaging	0.98
R0581:Stat6	UTSW	10	127648116	missense	probably damaging	0.99
R0735:Stat6	UTSW	10	127658241	missense	probably damaging	1.00
R1333:Stat6	UTSW	10	127651225	missense	possibly damaging	0.62
R1352:Stat6	UTSW	10	127650811	missense	probably benign	0.32
R1457:Stat6	UTSW	10	127658245	missense	probably damaging	0.98
R1538:Stat6	UTSW	10	127653256	missense	probably damaging	1.00
R1696:Stat6	UTSW	10	127653049	missense	probably damaging	1.00
R3236:Stat6	UTSW	10	127652222	missense	possibly damaging	0.93
R3980:Stat6	UTSW	10	127655379	missense	probably damaging	1.00
R4467:Stat6	UTSW	10	127651228	missense	probably damaging	1.00
R5346:Stat6	UTSW	10	127652313	missense	probably benign	0.44
R5481:Stat6	UTSW	10	127647826	splice site	probably null
R5722:Stat6	UTSW	10	127658373	missense	probably benign	0.00
R6036:Stat6	UTSW	10	127655444	missense	possibly damaging	0.58
R6036:Stat6	UTSW	10	127655444	missense	possibly damaging	0.58
R6244:Stat6	UTSW	10	127657712	splice site	probably null
R6914:Stat6	UTSW	10	127651262	missense	probably damaging	1.00
R6937:Stat6	UTSW	10	127658702	critical splice donor site	probably null
R6942:Stat6	UTSW	10	127651262	missense	probably damaging	1.00
R8231:Stat6	UTSW	10	127646973	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- CAACTTCTGTGGAGGGGTAGAG -3'
(R):5'- TGGACCAGGACCATTGACAG -3'

Sequencing Primer
(F):5'- CTTCTGTGGAGGGGTAGAGGTAAAC -3'
(R):5'- CAGGAGGGTCTATCAAATTCTGC -3'

Posted On

2014-08-25