Incidental Mutation 'R2016:Nle1'
ID223068
Institutional Source Beutler Lab
Gene Symbol Nle1
Ensembl Gene ENSMUSG00000020692
Gene Namenotchless homolog 1
Synonymsnotchless, Nle, l11Jus4, l11Jus1
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82900768-82908411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82905547 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 166 (P166Q)
Ref Sequence ENSEMBL: ENSMUSP00000099502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018988] [ENSMUST00000103213]
Predicted Effect probably benign
Transcript: ENSMUST00000018988
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103213
AA Change: P166Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692
AA Change: P166Q

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124109
Predicted Effect probably benign
Transcript: ENSMUST00000126202
SMART Domains Protein: ENSMUSP00000130605
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
SCOP:d1flga_ 12 46 2e-5 SMART
Blast:WD40 22 48 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147915
Predicted Effect probably benign
Transcript: ENSMUST00000167196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170815
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation, most blastocysts fail to hatch out of the zona pellucida, and apoptosis is increased in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kif13a T C 13: 46,810,799 D475G probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Nle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nle1 APN 11 82904307 nonsense probably null
IGL02945:Nle1 APN 11 82904084 splice site probably benign
IGL03170:Nle1 APN 11 82904270 missense probably benign
R0401:Nle1 UTSW 11 82905379 unclassified probably benign
R0646:Nle1 UTSW 11 82904845 missense probably damaging 1.00
R1958:Nle1 UTSW 11 82904242 missense probably benign 0.01
R1966:Nle1 UTSW 11 82901788 missense probably damaging 1.00
R2017:Nle1 UTSW 11 82905547 missense probably damaging 1.00
R2049:Nle1 UTSW 11 82905366 missense probably damaging 1.00
R2140:Nle1 UTSW 11 82905568 missense probably damaging 0.99
R2289:Nle1 UTSW 11 82903053 missense probably benign 0.01
R4354:Nle1 UTSW 11 82906431 missense possibly damaging 0.65
R4963:Nle1 UTSW 11 82904937 missense probably benign 0.04
R4964:Nle1 UTSW 11 82908192 missense probably damaging 1.00
R5257:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5258:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5509:Nle1 UTSW 11 82903182 missense possibly damaging 0.92
R6160:Nle1 UTSW 11 82908157 missense probably benign 0.01
R7206:Nle1 UTSW 11 82904931 missense probably benign 0.35
R7696:Nle1 UTSW 11 82904966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTTGCTGTGGCCAGTGAG -3'
(R):5'- ACTAGGGAGTGGCAGTGTTATC -3'

Sequencing Primer
(F):5'- TTGGGTCCCACAGCAGAAC -3'
(R):5'- CAGTGTTATCTGCAGAAAGCTG -3'
Posted On2014-08-25