Incidental Mutation 'R2016:Kif13a'
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 040025-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R2016 (G1)
Quality Score225
Status Not validated
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46810799 bp
Amino Acid Change Aspartic acid to Glycine at position 475 (D475G)
Ref Sequence ENSEMBL: ENSMUSP00000055304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]
Predicted Effect probably benign
Transcript: ENSMUST00000056978
AA Change: D475G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: D475G

KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225591
AA Change: D412G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abca8a A G 11: 110,070,387 F570L probably damaging Het
Adck1 T A 12: 88,461,092 I493N probably damaging Het
Adra2c T C 5: 35,280,312 C143R probably damaging Het
Akap13 C T 7: 75,704,531 T1800M probably damaging Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcam G A 7: 19,760,349 T374M probably benign Het
Blm T C 7: 80,505,926 D335G probably benign Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Csf2ra T G 19: 61,226,893 M95L probably benign Het
Cyp2c70 T A 19: 40,164,412 T300S possibly damaging Het
Cyp4f15 A T 17: 32,702,159 H440L probably damaging Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Ddr2 T C 1: 169,984,968 M652V probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dpysl5 G A 5: 30,791,597 D399N probably damaging Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Efl1 A C 7: 82,753,709 D673A probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Erap1 T C 13: 74,664,151 W362R probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam234a A G 17: 26,218,316 F91L probably benign Het
Fam71e2 A T 7: 4,759,398 I244N probably damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gnl3 A G 14: 31,016,369 probably null Het
Has1 A T 17: 17,848,270 I274N probably damaging Het
Itsn1 T C 16: 91,905,501 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl20 A T 1: 161,103,038 M298K probably damaging Het
Kynu G T 2: 43,604,277 G241* probably null Het
Lrif1 G T 3: 106,732,206 L202F possibly damaging Het
Lrp5 T C 19: 3,610,056 K1003E probably benign Het
Mamdc2 T C 19: 23,334,029 D487G probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Mettl25 T A 10: 105,797,306 E425D probably benign Het
Midn G T 10: 80,150,115 R13L possibly damaging Het
Mtmr9 T C 14: 63,540,264 Y136C possibly damaging Het
Mylk G A 16: 34,996,817 V61M probably damaging Het
Nalcn T C 14: 123,594,581 probably null Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 C595Y probably damaging Het
Olfr1133 C T 2: 87,646,052 V24M probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr724 A G 14: 49,960,502 I190T probably benign Het
Olfr906 A T 9: 38,488,013 probably null Het
Olfr963 A G 9: 39,669,555 Y166C probably damaging Het
Pds5a T A 5: 65,648,007 probably null Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Plcl2 G A 17: 50,606,694 V244M probably damaging Het
Plk1 A G 7: 122,162,440 K257R probably damaging Het
Prkcg A T 7: 3,323,550 T460S probably damaging Het
Prl7d1 G A 13: 27,710,173 H138Y probably damaging Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Pwwp2b A T 7: 139,256,151 I503F possibly damaging Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Sall1 A G 8: 89,028,409 V1314A probably benign Het
Sema6c A G 3: 95,171,234 I549V probably benign Het
Slc17a1 A G 13: 23,878,539 S230G probably benign Het
Slc5a4a T G 10: 76,153,580 F106V probably benign Het
Spata5 T C 3: 37,578,762 V839A possibly damaging Het
Stat6 T C 10: 127,650,796 L147P probably damaging Het
Taar7d T A 10: 24,027,744 S175T probably benign Het
Tmem132b A G 5: 125,623,016 Q206R probably benign Het
Tmem229a T C 6: 24,955,062 D231G probably benign Het
Trim66 A G 7: 109,472,232 probably null Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Ttll9 A T 2: 153,002,294 E374V probably damaging Het
Vmn2r69 A T 7: 85,407,285 D548E probably damaging Het
Zcchc2 T A 1: 106,004,121 probably null Het
Zfp282 T A 6: 47,897,787 probably null Het
Zfp352 A G 4: 90,225,171 E516G probably benign Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5047:Kif13a UTSW 13 46788085 missense probably benign 0.00
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25