Mutagenetix > Incidental Mutations

Incidental Mutation 'R2016:Kif13a'

223085

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

040025-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R2016 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46810799 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 475 (D475G)

Ref Sequence

ENSEMBL: ENSMUSP00000055304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]

Predicted Effect

probably benign
Transcript: ENSMUST00000056978
AA Change: D475G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: D475G

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225591
AA Change: D412G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025C18Rik	T	C	2: 165,079,026	D29G	unknown	Het
Abca13	A	T	11: 9,290,619	L827F	probably damaging	Het
Abca8a	A	G	11: 110,070,387	F570L	probably damaging	Het
Adck1	T	A	12: 88,461,092	I493N	probably damaging	Het
Adra2c	T	C	5: 35,280,312	C143R	probably damaging	Het
Akap13	C	T	7: 75,704,531	T1800M	probably damaging	Het
Angpt2	T	C	8: 18,705,731	N240S	probably damaging	Het
Apob	G	A	12: 8,007,751	D2078N	possibly damaging	Het
Atp8b1	T	C	18: 64,540,334	N989S	probably damaging	Het
B3gnt2	T	C	11: 22,836,621	D189G	probably damaging	Het
Bcam	G	A	7: 19,760,349	T374M	probably benign	Het
Blm	T	C	7: 80,505,926	D335G	probably benign	Het
Cbfa2t2	T	C	2: 154,517,807	L264P	probably damaging	Het
Col4a2	T	C	8: 11,445,086	F1515L	probably benign	Het
Csf2ra	T	G	19: 61,226,893	M95L	probably benign	Het
Cyp2c70	T	A	19: 40,164,412	T300S	possibly damaging	Het
Cyp4f15	A	T	17: 32,702,159	H440L	probably damaging	Het
Dcaf1	T	A	9: 106,839,088	D360E	probably benign	Het
Ddr2	T	C	1: 169,984,968	M652V	probably damaging	Het
Dnah2	T	A	11: 69,437,070	I3370F	probably damaging	Het
Dpysl5	G	A	5: 30,791,597	D399N	probably damaging	Het
Efemp1	G	T	11: 28,921,613	R376L	probably damaging	Het
Efl1	A	C	7: 82,753,709	D673A	probably damaging	Het
Eid1	A	G	2: 125,673,201	M4V	probably benign	Het
Emc10	G	A	7: 44,493,192	R109W	probably damaging	Het
Emilin3	G	A	2: 160,909,610	R170C	possibly damaging	Het
Erap1	T	C	13: 74,664,151	W362R	probably damaging	Het
Fam208b	A	T	13: 3,576,770	I1060K	probably benign	Het
Fam234a	A	G	17: 26,218,316	F91L	probably benign	Het
Fam71e2	A	T	7: 4,759,398	I244N	probably damaging	Het
Flnc	G	A	6: 29,443,797		probably null	Het
Fsip2	A	G	2: 82,982,732	K3132E	possibly damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably benign	Het
Gnl3	A	G	14: 31,016,369		probably null	Het
Has1	A	T	17: 17,848,270	I274N	probably damaging	Het
Itsn1	T	C	16: 91,905,501		probably null	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906		probably benign	Het
Klhl20	A	T	1: 161,103,038	M298K	probably damaging	Het
Kynu	G	T	2: 43,604,277	G241*	probably null	Het
Lrif1	G	T	3: 106,732,206	L202F	possibly damaging	Het
Lrp5	T	C	19: 3,610,056	K1003E	probably benign	Het
Mamdc2	T	C	19: 23,334,029	D487G	probably damaging	Het
Mapk8ip1	A	G	2: 92,391,034		probably null	Het
Mettl25	T	A	10: 105,797,306	E425D	probably benign	Het
Midn	G	T	10: 80,150,115	R13L	possibly damaging	Het
Mtmr9	T	C	14: 63,540,264	Y136C	possibly damaging	Het
Mylk	G	A	16: 34,996,817	V61M	probably damaging	Het
Nalcn	T	C	14: 123,594,581		probably null	Het
Nle1	G	T	11: 82,905,547	P166Q	probably damaging	Het
Nr4a3	G	A	4: 48,083,252	C595Y	probably damaging	Het
Olfr1133	C	T	2: 87,646,052	V24M	probably benign	Het
Olfr1288	G	T	2: 111,479,187	M134I	probably benign	Het
Olfr724	A	G	14: 49,960,502	I190T	probably benign	Het
Olfr906	A	T	9: 38,488,013		probably null	Het
Olfr963	A	G	9: 39,669,555	Y166C	probably damaging	Het
Pds5a	T	A	5: 65,648,007		probably null	Het
Pitpnm1	T	C	19: 4,111,873	V955A	probably benign	Het
Plcb1	T	A	2: 135,362,420	I898N	possibly damaging	Het
Plcl2	G	A	17: 50,606,694	V244M	probably damaging	Het
Plk1	A	G	7: 122,162,440	K257R	probably damaging	Het
Prkcg	A	T	7: 3,323,550	T460S	probably damaging	Het
Prl7d1	G	A	13: 27,710,173	H138Y	probably damaging	Het
Prss35	A	G	9: 86,755,512	S112G	probably benign	Het
Ptprj	C	T	2: 90,464,614	V417M	probably damaging	Het
Pwwp2b	A	T	7: 139,256,151	I503F	possibly damaging	Het
Rasgrp2	T	C	19: 6,413,165	V498A	probably benign	Het
Sall1	A	G	8: 89,028,409	V1314A	probably benign	Het
Sema6c	A	G	3: 95,171,234	I549V	probably benign	Het
Slc17a1	A	G	13: 23,878,539	S230G	probably benign	Het
Slc5a4a	T	G	10: 76,153,580	F106V	probably benign	Het
Spata5	T	C	3: 37,578,762	V839A	possibly damaging	Het
Stat6	T	C	10: 127,650,796	L147P	probably damaging	Het
Taar7d	T	A	10: 24,027,744	S175T	probably benign	Het
Tmem132b	A	G	5: 125,623,016	Q206R	probably benign	Het
Tmem229a	T	C	6: 24,955,062	D231G	probably benign	Het
Trim66	A	G	7: 109,472,232		probably null	Het
Ttc30a1	A	G	2: 75,981,457	L94P	probably benign	Het
Ttll9	A	T	2: 153,002,294	E374V	probably damaging	Het
Vmn2r69	A	T	7: 85,407,285	D548E	probably damaging	Het
Zcchc2	T	A	1: 106,004,121		probably null	Het
Zfp282	T	A	6: 47,897,787		probably null	Het
Zfp352	A	G	4: 90,225,171	E516G	probably benign	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TCTTACTTTGACATAACTGCAATAAGC -3'
(R):5'- AATGTTTGAAGGTAAGCTTTTGGC -3'

Sequencing Primer
(F):5'- CAATAAGCAAGGGGAAAGGGCC -3'
(R):5'- ATGCCGTTATCCGATGAGAC -3'

Posted On

2014-08-25