Incidental Mutation 'R1989:Upk1b'
ID 223098
Institutional Source Beutler Lab
Gene Symbol Upk1b
Ensembl Gene ENSMUSG00000049436
Gene Name uroplakin 1B
Synonyms Tspan20, Upk1
MMRRC Submission 040001-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1989 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 38593544-38620565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38604603 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 141 (W141R)
Ref Sequence ENSEMBL: ENSMUSP00000052469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057767]
AlphaFold Q9Z2C6
Predicted Effect possibly damaging
Transcript: ENSMUST00000057767
AA Change: W141R

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052469
Gene: ENSMUSG00000049436
AA Change: W141R

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 258 6.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232536
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can form a complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a reporter allele are viable, fertile, and physically and behaviorally normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,854,394 (GRCm39) D216V possibly damaging Het
Acaca T C 11: 84,153,355 (GRCm39) M921T probably damaging Het
Actn2 A T 13: 12,355,276 (GRCm39) W36R probably benign Het
Adcy9 A T 16: 4,116,591 (GRCm39) V643D probably damaging Het
Agbl4 A T 4: 111,423,879 (GRCm39) T302S possibly damaging Het
Akap13 A G 7: 75,354,264 (GRCm39) N1795S probably benign Het
Ang T A 14: 51,339,008 (GRCm39) C50S probably damaging Het
Anxa13 T A 15: 58,205,344 (GRCm39) noncoding transcript Het
Asxl3 T C 18: 22,585,420 (GRCm39) V115A probably damaging Het
B4galt5 A T 2: 167,146,923 (GRCm39) W304R probably damaging Het
Bptf T C 11: 106,965,652 (GRCm39) K1118E probably damaging Het
Cacna1b T C 2: 24,611,386 (GRCm39) Y335C probably damaging Het
Catsperb A T 12: 101,568,970 (GRCm39) I881F probably damaging Het
Ccn1 A T 3: 145,353,498 (GRCm39) Y355N probably benign Het
Chrm5 A G 2: 112,310,597 (GRCm39) V173A probably damaging Het
Cyfip2 A T 11: 46,144,825 (GRCm39) Y676* probably null Het
Cyp2f2 A G 7: 26,828,628 (GRCm39) D90G probably damaging Het
Dnah5 T C 15: 28,343,737 (GRCm39) I2379T probably damaging Het
E2f8 T C 7: 48,523,028 (GRCm39) E349G probably benign Het
Ebf1 T C 11: 44,512,793 (GRCm39) M134T probably damaging Het
Fn1 T C 1: 71,690,784 (GRCm39) H59R probably damaging Het
Focad T C 4: 88,151,021 (GRCm39) probably null Het
Gabra1 A T 11: 42,045,842 (GRCm39) D89E probably damaging Het
Hip1r G T 5: 124,127,761 (GRCm39) V90F probably damaging Het
Ifi213 C A 1: 173,396,374 (GRCm39) probably null Het
Kcnj9 A G 1: 172,153,716 (GRCm39) I136T probably benign Het
Kmt2c A G 5: 25,703,542 (GRCm39) S3P possibly damaging Het
Lrrc4b GAGAAG GAG 7: 44,111,654 (GRCm39) probably benign Het
Lrrk1 G A 7: 65,931,432 (GRCm39) S43L probably damaging Het
Macf1 A G 4: 123,391,519 (GRCm39) probably null Het
Mad1l1 A G 5: 140,289,425 (GRCm39) S167P probably benign Het
Maml3 G T 3: 51,605,179 (GRCm39) A64D probably damaging Het
Mgat4c T C 10: 102,214,020 (GRCm39) M1T probably null Het
Mkrn2os G T 6: 115,566,311 (GRCm39) T88K probably damaging Het
Mob3c T C 4: 115,688,754 (GRCm39) Y96H probably damaging Het
Mpo T A 11: 87,694,298 (GRCm39) I96N probably damaging Het
Mup17 T A 4: 61,511,860 (GRCm39) Y138F probably benign Het
Myh8 A G 11: 67,183,550 (GRCm39) I754V probably benign Het
Naa30 T A 14: 49,415,597 (GRCm39) L289* probably null Het
Nap1l4 A C 7: 143,080,921 (GRCm39) F292V probably damaging Het
Nek5 T A 8: 22,601,185 (GRCm39) N129Y probably damaging Het
Nlrp9a A G 7: 26,273,338 (GRCm39) E880G probably benign Het
Nsun6 G T 2: 15,042,995 (GRCm39) N155K probably benign Het
Or2aj5 A T 16: 19,425,407 (GRCm39) Y4N probably benign Het
Or4c102 T A 2: 88,422,943 (GRCm39) I265K probably damaging Het
Or4f62 T A 2: 111,986,722 (GRCm39) I142N probably benign Het
Or52a33 A T 7: 103,288,702 (GRCm39) I215K probably damaging Het
Or52ad1 T A 7: 102,995,316 (GRCm39) Y273F possibly damaging Het
Or5p5 A T 7: 107,413,907 (GRCm39) I39L probably benign Het
Or8d23 T C 9: 38,842,171 (GRCm39) S235P possibly damaging Het
Palm3 G A 8: 84,756,651 (GRCm39) S721N possibly damaging Het
Ppp2r5d C T 17: 46,995,025 (GRCm39) V559M probably benign Het
Ptgfr A T 3: 151,540,976 (GRCm39) Y177* probably null Het
Rnase10 A T 14: 51,247,095 (GRCm39) I121L probably benign Het
Sall2 G A 14: 52,551,896 (GRCm39) P431L probably damaging Het
Sbf2 A G 7: 109,948,130 (GRCm39) V1194A possibly damaging Het
Scimp T C 11: 70,682,402 (GRCm39) K105E possibly damaging Het
Scrt2 A T 2: 151,924,007 (GRCm39) D13V probably damaging Het
Snx19 A G 9: 30,339,404 (GRCm39) S181G possibly damaging Het
Spata2 G A 2: 167,326,234 (GRCm39) T195M possibly damaging Het
Sptbn4 A G 7: 27,067,127 (GRCm39) V614A probably damaging Het
Srpk2 G A 5: 23,723,421 (GRCm39) A565V probably damaging Het
Stard9 A G 2: 120,531,887 (GRCm39) I2715V probably benign Het
Sval1 A G 6: 41,932,425 (GRCm39) T92A possibly damaging Het
Synrg T C 11: 83,910,781 (GRCm39) probably null Het
Tlr12 T C 4: 128,510,862 (GRCm39) T463A probably benign Het
Tnxb A G 17: 34,902,351 (GRCm39) H945R probably benign Het
Tnxb A T 17: 34,912,859 (GRCm39) D1791V probably damaging Het
Topaz1 C T 9: 122,579,190 (GRCm39) T700I possibly damaging Het
Trappc8 A G 18: 20,978,708 (GRCm39) V796A probably benign Het
Trpm1 A T 7: 63,858,780 (GRCm39) probably null Het
Ttll4 G T 1: 74,724,527 (GRCm39) V566L possibly damaging Het
Ttn T A 2: 76,581,285 (GRCm39) N23203Y probably damaging Het
Ttn A T 2: 76,601,131 (GRCm39) Y18781N probably damaging Het
Tuba3a T C 6: 125,258,216 (GRCm39) N258S probably damaging Het
Vars1 T C 17: 35,230,814 (GRCm39) F567L possibly damaging Het
Vcpip1 G C 1: 9,815,788 (GRCm39) A865G probably benign Het
Vmn2r22 A T 6: 123,614,500 (GRCm39) F363L probably damaging Het
Vmn2r66 A T 7: 84,661,201 (GRCm39) F10I probably benign Het
Wbp2 C T 11: 115,971,047 (GRCm39) probably null Het
Yy1 T C 12: 108,772,534 (GRCm39) L270P probably damaging Het
Zan A T 5: 137,418,268 (GRCm39) C2943* probably null Het
Zfp51 T A 17: 21,676,582 (GRCm39) Y18N possibly damaging Het
Other mutations in Upk1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Upk1b APN 16 38,600,378 (GRCm39) missense possibly damaging 0.93
IGL00953:Upk1b APN 16 38,600,347 (GRCm39) missense possibly damaging 0.95
IGL02879:Upk1b APN 16 38,596,640 (GRCm39) splice site probably benign
IGL03067:Upk1b APN 16 38,605,272 (GRCm39) missense probably damaging 1.00
R0969:Upk1b UTSW 16 38,607,661 (GRCm39) splice site probably benign
R1755:Upk1b UTSW 16 38,600,402 (GRCm39) missense probably benign 0.04
R1916:Upk1b UTSW 16 38,596,548 (GRCm39) critical splice donor site probably null
R2101:Upk1b UTSW 16 38,600,499 (GRCm39) nonsense probably null
R2375:Upk1b UTSW 16 38,607,490 (GRCm39) missense probably damaging 1.00
R4564:Upk1b UTSW 16 38,600,469 (GRCm39) missense probably benign 0.00
R4796:Upk1b UTSW 16 38,607,604 (GRCm39) missense probably benign 0.28
R8263:Upk1b UTSW 16 38,604,585 (GRCm39) missense probably damaging 1.00
R8788:Upk1b UTSW 16 38,607,463 (GRCm39) missense probably damaging 1.00
R9008:Upk1b UTSW 16 38,607,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTATGCAGGCGATCAC -3'
(R):5'- TTTAGCTTCCCTCCAAGAGAATGTG -3'

Sequencing Primer
(F):5'- GGTAATCACCCTGGGACCAC -3'
(R):5'- CCTCCAAGAGAATGTGCAGTTTATAG -3'
Posted On 2014-08-25