Incidental Mutation 'R2016:Nalcn'
ID 223099
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 040025-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2016 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 123831993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000000201
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 164,920,946 (GRCm39) D29G unknown Het
Abca13 A T 11: 9,240,619 (GRCm39) L827F probably damaging Het
Abca8a A G 11: 109,961,213 (GRCm39) F570L probably damaging Het
Adck1 T A 12: 88,427,862 (GRCm39) I493N probably damaging Het
Adra2c T C 5: 35,437,656 (GRCm39) C143R probably damaging Het
Afg2a T C 3: 37,632,911 (GRCm39) V839A possibly damaging Het
Akap13 C T 7: 75,354,279 (GRCm39) T1800M probably damaging Het
Angpt2 T C 8: 18,755,747 (GRCm39) N240S probably damaging Het
Apob G A 12: 8,057,751 (GRCm39) D2078N possibly damaging Het
Atp8b1 T C 18: 64,673,405 (GRCm39) N989S probably damaging Het
B3gnt2 T C 11: 22,786,621 (GRCm39) D189G probably damaging Het
Bcam G A 7: 19,494,274 (GRCm39) T374M probably benign Het
Blm T C 7: 80,155,674 (GRCm39) D335G probably benign Het
Cbfa2t2 T C 2: 154,359,727 (GRCm39) L264P probably damaging Het
Col4a2 T C 8: 11,495,086 (GRCm39) F1515L probably benign Het
Csf2ra T G 19: 61,215,331 (GRCm39) M95L probably benign Het
Cyp2c70 T A 19: 40,152,856 (GRCm39) T300S possibly damaging Het
Cyp4f15 A T 17: 32,921,133 (GRCm39) H440L probably damaging Het
Dcaf1 T A 9: 106,716,287 (GRCm39) D360E probably benign Het
Ddr2 T C 1: 169,812,537 (GRCm39) M652V probably damaging Het
Dnah2 T A 11: 69,327,896 (GRCm39) I3370F probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Efemp1 G T 11: 28,871,613 (GRCm39) R376L probably damaging Het
Efl1 A C 7: 82,402,917 (GRCm39) D673A probably damaging Het
Eid1 A G 2: 125,515,121 (GRCm39) M4V probably benign Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Emilin3 G A 2: 160,751,530 (GRCm39) R170C possibly damaging Het
Erap1 T C 13: 74,812,270 (GRCm39) W362R probably damaging Het
Fam234a A G 17: 26,437,290 (GRCm39) F91L probably benign Het
Flnc G A 6: 29,443,796 (GRCm39) probably null Het
Fsip2 A G 2: 82,813,076 (GRCm39) K3132E possibly damaging Het
Garin5b A T 7: 4,762,397 (GRCm39) I244N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gnl3 A G 14: 30,738,326 (GRCm39) probably null Het
Has1 A T 17: 18,068,532 (GRCm39) I274N probably damaging Het
Ift70a1 A G 2: 75,811,801 (GRCm39) L94P probably benign Het
Itsn1 T C 16: 91,702,389 (GRCm39) probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kif13a T C 13: 46,964,275 (GRCm39) D475G probably benign Het
Klhl20 A T 1: 160,930,608 (GRCm39) M298K probably damaging Het
Kynu G T 2: 43,494,289 (GRCm39) G241* probably null Het
Lrif1 G T 3: 106,639,522 (GRCm39) L202F possibly damaging Het
Lrp5 T C 19: 3,660,056 (GRCm39) K1003E probably benign Het
Mamdc2 T C 19: 23,311,393 (GRCm39) D487G probably damaging Het
Mapk8ip1 A G 2: 92,221,379 (GRCm39) probably null Het
Mettl25 T A 10: 105,633,167 (GRCm39) E425D probably benign Het
Midn G T 10: 79,985,949 (GRCm39) R13L possibly damaging Het
Mtmr9 T C 14: 63,777,713 (GRCm39) Y136C possibly damaging Het
Mylk G A 16: 34,817,187 (GRCm39) V61M probably damaging Het
Nle1 G T 11: 82,796,373 (GRCm39) P166Q probably damaging Het
Nr4a3 G A 4: 48,083,252 (GRCm39) C595Y probably damaging Het
Or10d4 A G 9: 39,580,851 (GRCm39) Y166C probably damaging Het
Or4g7 G T 2: 111,309,532 (GRCm39) M134I probably benign Het
Or4l15 A G 14: 50,197,959 (GRCm39) I190T probably benign Het
Or5w1b C T 2: 87,476,396 (GRCm39) V24M probably benign Het
Or8b1 A T 9: 38,399,309 (GRCm39) probably null Het
Pds5a T A 5: 65,805,350 (GRCm39) probably null Het
Pitpnm1 T C 19: 4,161,873 (GRCm39) V955A probably benign Het
Plcb1 T A 2: 135,204,340 (GRCm39) I898N possibly damaging Het
Plcl2 G A 17: 50,913,722 (GRCm39) V244M probably damaging Het
Plk1 A G 7: 121,761,663 (GRCm39) K257R probably damaging Het
Prkcg A T 7: 3,372,066 (GRCm39) T460S probably damaging Het
Prl7d1 G A 13: 27,894,156 (GRCm39) H138Y probably damaging Het
Prss35 A G 9: 86,637,565 (GRCm39) S112G probably benign Het
Ptprj C T 2: 90,294,958 (GRCm39) V417M probably damaging Het
Pwwp2b A T 7: 138,836,067 (GRCm39) I503F possibly damaging Het
Rasgrp2 T C 19: 6,463,195 (GRCm39) V498A probably benign Het
Sall1 A G 8: 89,755,037 (GRCm39) V1314A probably benign Het
Sema6c A G 3: 95,078,545 (GRCm39) I549V probably benign Het
Slc17a1 A G 13: 24,062,522 (GRCm39) S230G probably benign Het
Slc5a4a T G 10: 75,989,414 (GRCm39) F106V probably benign Het
Stat6 T C 10: 127,486,665 (GRCm39) L147P probably damaging Het
Taar7d T A 10: 23,903,642 (GRCm39) S175T probably benign Het
Tasor2 A T 13: 3,626,770 (GRCm39) I1060K probably benign Het
Tmem132b A G 5: 125,700,080 (GRCm39) Q206R probably benign Het
Tmem229a T C 6: 24,955,061 (GRCm39) D231G probably benign Het
Trim66 A G 7: 109,071,439 (GRCm39) probably null Het
Ttll9 A T 2: 152,844,214 (GRCm39) E374V probably damaging Het
Vmn2r69 A T 7: 85,056,493 (GRCm39) D548E probably damaging Het
Zcchc2 T A 1: 105,931,851 (GRCm39) probably null Het
Zfp282 T A 6: 47,874,721 (GRCm39) probably null Het
Zfp352 A G 4: 90,113,408 (GRCm39) E516G probably benign Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0359:Nalcn UTSW 14 123,536,580 (GRCm39) missense probably damaging 1.00
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0400:Nalcn UTSW 14 123,528,372 (GRCm39) splice site probably benign
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1689:Nalcn UTSW 14 123,522,666 (GRCm39) missense probably damaging 1.00
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2149:Nalcn UTSW 14 123,607,429 (GRCm39) missense probably benign 0.01
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123,752,777 (GRCm39) missense probably damaging 1.00
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7018:Nalcn UTSW 14 123,647,233 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCACATTTGAAATGCATTC -3'
(R):5'- AAGCGCTCATTAGCCTCTGTTAC -3'

Sequencing Primer
(F):5'- CCACATTTGAAATGCATTCCTTAATG -3'
(R):5'- ACTGTTGATGGCTTTGACT -3'
Posted On 2014-08-25