Incidental Mutation 'R2002:Hjurp'
ID 223125
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission 040012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R2002 (G1)
Quality Score 217
Status Validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) GT to GTT at 88194246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,489,002 (GRCm39) noncoding transcript Het
Abcb4 T A 5: 8,955,989 (GRCm39) S98T probably benign Het
Acan T C 7: 78,750,541 (GRCm39) S1771P probably damaging Het
Acvr1c T A 2: 58,205,987 (GRCm39) Q41L probably benign Het
Ak2 T A 4: 128,902,022 (GRCm39) S232T probably benign Het
Akr1e1 T A 13: 4,657,564 (GRCm39) probably benign Het
Ano7 T C 1: 93,328,303 (GRCm39) probably benign Het
Aox1 T A 1: 58,086,300 (GRCm39) H68Q possibly damaging Het
Apaf1 A G 10: 90,897,676 (GRCm39) V269A possibly damaging Het
Apba2 A T 7: 64,383,290 (GRCm39) I368F probably damaging Het
Armc3 A G 2: 19,293,747 (GRCm39) M513V probably benign Het
Asb5 G A 8: 55,036,655 (GRCm39) V116M probably damaging Het
Atg16l2 A G 7: 100,944,127 (GRCm39) S280P possibly damaging Het
Atp6v0c G T 17: 24,383,835 (GRCm39) T40K probably damaging Het
Cdk2ap2 A G 19: 4,147,903 (GRCm39) M57V possibly damaging Het
Cip2a T C 16: 48,826,214 (GRCm39) probably benign Het
Ctnnd1 T C 2: 84,450,704 (GRCm39) N172S probably benign Het
Ddx55 T A 5: 124,704,503 (GRCm39) V370E probably damaging Het
Ddx6 A G 9: 44,518,831 (GRCm39) T48A probably benign Het
Dnah10 C T 5: 124,911,052 (GRCm39) R4490W probably damaging Het
Dspp T A 5: 104,326,425 (GRCm39) S929R unknown Het
Erbb3 T C 10: 128,422,094 (GRCm39) Y50C probably benign Het
Fam209 C A 2: 172,314,689 (GRCm39) N59K probably benign Het
Fgd3 T C 13: 49,449,931 (GRCm39) E106G probably benign Het
Frmd4a A C 2: 4,577,176 (GRCm39) K344T probably damaging Het
Gbe1 A G 16: 70,325,814 (GRCm39) E617G probably damaging Het
Gm5089 T A 14: 122,673,686 (GRCm39) I12F unknown Het
Gm7052 T A 17: 22,258,920 (GRCm39) probably benign Het
Gria1 A T 11: 56,902,930 (GRCm39) N24I possibly damaging Het
Grin2b T C 6: 135,710,243 (GRCm39) E1101G probably damaging Het
Kcnma1 A C 14: 23,387,097 (GRCm39) S982A probably damaging Het
Khdrbs3 T A 15: 68,885,328 (GRCm39) probably benign Het
Kif23 A T 9: 61,834,666 (GRCm39) C426* probably null Het
Lmo7 G T 14: 102,124,497 (GRCm39) A319S probably benign Het
Ly6c1 T A 15: 74,920,342 (GRCm39) T7S possibly damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Mamdc4 A T 2: 25,457,244 (GRCm39) W548R probably damaging Het
Mfsd2a C T 4: 122,850,609 (GRCm39) R88Q probably damaging Het
Mkrn1 T C 6: 39,382,737 (GRCm39) T158A probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mycbp2 A G 14: 103,485,839 (GRCm39) V1041A probably damaging Het
Ncam2 A T 16: 81,386,586 (GRCm39) H655L possibly damaging Het
Npas2 T C 1: 39,377,276 (GRCm39) V546A probably benign Het
Nrxn3 G A 12: 90,299,089 (GRCm39) A400T probably damaging Het
Oog3 G T 4: 143,884,675 (GRCm39) H420Q possibly damaging Het
Or3a10 A T 11: 73,935,865 (GRCm39) S78R possibly damaging Het
Or5ap2 T A 2: 85,680,744 (GRCm39) V316E probably benign Het
Or8k28 T C 2: 86,285,817 (GRCm39) H266R probably benign Het
Pak5 T A 2: 135,958,557 (GRCm39) H177L probably benign Het
Pcca A G 14: 123,124,477 (GRCm39) I683V probably benign Het
Pea15a T C 1: 172,026,252 (GRCm39) I90V probably benign Het
Plagl1 C A 10: 13,004,402 (GRCm39) probably benign Het
Prmt1 A G 7: 44,628,148 (GRCm39) V237A probably damaging Het
Ptprz1 T A 6: 23,027,833 (GRCm39) Y910* probably null Het
Rasal3 T A 17: 32,612,585 (GRCm39) T757S probably damaging Het
Rbbp8 T C 18: 11,860,223 (GRCm39) probably benign Het
S1pr1 A G 3: 115,506,544 (GRCm39) S17P probably benign Het
Scel G A 14: 103,779,421 (GRCm39) V131M probably damaging Het
Scn2a G A 2: 65,512,427 (GRCm39) R188Q probably null Het
Snap29 T A 16: 17,224,190 (GRCm39) Y68* probably null Het
Spdl1 T C 11: 34,713,473 (GRCm39) T199A probably benign Het
Srbd1 T C 17: 86,449,828 (GRCm39) N14D probably benign Het
Ston1 G A 17: 88,942,957 (GRCm39) G121D probably benign Het
Syt16 G A 12: 74,281,977 (GRCm39) G367E possibly damaging Het
Tdpoz1 T C 3: 93,578,710 (GRCm39) T25A possibly damaging Het
Tmem182 T A 1: 40,845,355 (GRCm39) Y77N probably damaging Het
Tmprss11f A T 5: 86,687,627 (GRCm39) probably benign Het
Trp73 T C 4: 154,165,902 (GRCm39) T56A probably damaging Het
Trpm3 A G 19: 22,959,947 (GRCm39) K1194R probably damaging Het
Ttc39c T A 18: 12,830,935 (GRCm39) probably null Het
Ube4b T C 4: 149,468,254 (GRCm39) D174G probably benign Het
Vmn1r211 A T 13: 23,035,953 (GRCm39) M238K probably damaging Het
Wsb2 T A 5: 117,508,798 (GRCm39) N77K probably benign Het
Xkr4 C T 1: 3,741,318 (GRCm39) R85Q probably benign Het
Zmynd11 T A 13: 9,739,514 (GRCm39) probably null Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- ACTGTCATGGTTTGTGATGCCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On 2014-08-25