Incidental Mutation 'R2002:Acvr1c'
ID223140
Institutional Source Beutler Lab
Gene Symbol Acvr1c
Ensembl Gene ENSMUSG00000026834
Gene Nameactivin A receptor, type IC
SynonymsALK7, Alk-7
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58267453-58357895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58315975 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 41 (Q41L)
Ref Sequence ENSEMBL: ENSMUSP00000028178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028178] [ENSMUST00000100085] [ENSMUST00000112607] [ENSMUST00000112608] [ENSMUST00000154453]
Predicted Effect probably benign
Transcript: ENSMUST00000028178
AA Change: Q41L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028178
Gene: ENSMUSG00000026834
AA Change: Q41L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.1e-13 PFAM
transmembrane domain 114 136 N/A INTRINSIC
GS 165 195 1.07e-13 SMART
Blast:TyrKc 201 472 3e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100085
SMART Domains Protein: ENSMUSP00000097663
Gene: ENSMUSG00000026834

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 1.1e-7 PFAM
Pfam:TGF_beta_GS 51 63 2.6e-7 PFAM
Pfam:Pkinase 65 352 5.6e-51 PFAM
Pfam:Pkinase_Tyr 65 352 4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112607
AA Change: Q41L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108226
Gene: ENSMUSG00000026834
AA Change: Q41L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.5e-15 PFAM
Pfam:Pkinase 51 325 9.5e-37 PFAM
Pfam:Pkinase_Tyr 92 325 4.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112608
AA Change: Q41L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108227
Gene: ENSMUSG00000026834
AA Change: Q41L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 4.9e-15 PFAM
Pfam:TGF_beta_GS 101 113 1.2e-8 PFAM
Pfam:Pkinase 115 402 2.3e-51 PFAM
Pfam:Pkinase_Tyr 115 402 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154453
SMART Domains Protein: ENSMUSP00000119776
Gene: ENSMUSG00000026834

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 2.7e-9 PFAM
Meta Mutation Damage Score 0.2274 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal with no apparent left-right patterning abnormalities or organogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Acvr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Acvr1c APN 2 58315855 missense probably damaging 1.00
IGL00543:Acvr1c APN 2 58315823 missense probably damaging 1.00
IGL01287:Acvr1c APN 2 58280242 nonsense probably null
IGL01313:Acvr1c APN 2 58315974 missense probably benign 0.10
IGL01722:Acvr1c APN 2 58283549 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0329:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R0330:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R1311:Acvr1c UTSW 2 58280249 missense probably benign 0.04
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1511:Acvr1c UTSW 2 58287884 missense probably damaging 1.00
R1813:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1896:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1935:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1939:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1940:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R2001:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2305:Acvr1c UTSW 2 58281699 missense probably damaging 1.00
R4786:Acvr1c UTSW 2 58280354 missense probably damaging 1.00
R4947:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R5121:Acvr1c UTSW 2 58281650 missense probably damaging 1.00
R5133:Acvr1c UTSW 2 58283506 missense probably damaging 1.00
R5381:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5383:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5647:Acvr1c UTSW 2 58295964 missense probably damaging 1.00
R5988:Acvr1c UTSW 2 58315874 missense probably damaging 1.00
R6860:Acvr1c UTSW 2 58287705 missense probably damaging 1.00
R7137:Acvr1c UTSW 2 58283387 critical splice donor site probably null
R7200:Acvr1c UTSW 2 58315855 missense probably damaging 1.00
R7278:Acvr1c UTSW 2 58284936 missense probably damaging 1.00
R8029:Acvr1c UTSW 2 58296117 missense possibly damaging 0.95
R8504:Acvr1c UTSW 2 58283479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACTGTCTTACCTGTGGGAAG -3'
(R):5'- AACCTATTTGATGAAGCACAGGATC -3'

Sequencing Primer
(F):5'- CCTGTGGGAAGGTGCAG -3'
(R):5'- CACAGGATCAAGAGGGCATCTTTATC -3'
Posted On2014-08-25