Incidental Mutation 'R2017:Cbfa2t2'
Institutional Source Beutler Lab
Gene Symbol Cbfa2t2
Ensembl Gene ENSMUSG00000038533
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)
SynonymsCbfa2t2h, MTGR1, C330013D05Rik
MMRRC Submission 040026-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosomal Location154436481-154539356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154517807 bp
Amino Acid Change Leucine to Proline at position 264 (L264P)
Ref Sequence ENSEMBL: ENSMUSP00000096782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109724] [ENSMUST00000109725]
Predicted Effect probably damaging
Transcript: ENSMUST00000045270
AA Change: L264P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533
AA Change: L264P

low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1.3e-40 PFAM
PDB:2KYG|C 420 450 3e-7 PDB
Pfam:zf-MYND 498 534 1.4e-9 PFAM
low complexity region 573 588 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099178
AA Change: L264P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533
AA Change: L264P

low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 4.4e-40 PFAM
low complexity region 402 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109724
AA Change: L216P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105346
Gene: ENSMUSG00000038533
AA Change: L216P

TAFH 58 148 1.06e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109725
AA Change: L264P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533
AA Change: L264P

low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1e-40 PFAM
Pfam:zf-MYND 497 533 3.3e-11 PFAM
low complexity region 572 587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135647
Predicted Effect probably benign
Transcript: ENSMUST00000137526
SMART Domains Protein: ENSMUSP00000118371
Gene: ENSMUSG00000038533

low complexity region 11 20 N/A INTRINSIC
Pfam:NHR2 28 94 2e-41 PFAM
Pfam:zf-MYND 203 239 3.1e-10 PFAM
low complexity region 278 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Cbfa2t2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cbfa2t2 APN 2 154528875 missense probably damaging 1.00
IGL01913:Cbfa2t2 APN 2 154517773 missense probably damaging 1.00
IGL02090:Cbfa2t2 APN 2 154531416 splice site probably benign
IGL02850:Cbfa2t2 APN 2 154535170 missense probably damaging 0.97
R0302:Cbfa2t2 UTSW 2 154534876 splice site probably benign
R0356:Cbfa2t2 UTSW 2 154531349 missense probably benign 0.03
R1218:Cbfa2t2 UTSW 2 154523919 missense probably benign 0.43
R1571:Cbfa2t2 UTSW 2 154500427 missense probably damaging 1.00
R1998:Cbfa2t2 UTSW 2 154504789 missense probably damaging 1.00
R2016:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2056:Cbfa2t2 UTSW 2 154535157 missense probably damaging 1.00
R3617:Cbfa2t2 UTSW 2 154436984 intron probably benign
R4299:Cbfa2t2 UTSW 2 154523928 missense probably damaging 1.00
R4746:Cbfa2t2 UTSW 2 154523925 missense possibly damaging 0.94
R4969:Cbfa2t2 UTSW 2 154523980 missense probably damaging 1.00
R5058:Cbfa2t2 UTSW 2 154504745 missense probably damaging 1.00
R5109:Cbfa2t2 UTSW 2 154531373 missense probably damaging 1.00
R5381:Cbfa2t2 UTSW 2 154523929 missense probably damaging 1.00
R5573:Cbfa2t2 UTSW 2 154436862 intron probably benign
R5808:Cbfa2t2 UTSW 2 154517826 unclassified probably null
R5826:Cbfa2t2 UTSW 2 154500455 missense possibly damaging 0.90
R5977:Cbfa2t2 UTSW 2 154517777 missense probably damaging 1.00
R6052:Cbfa2t2 UTSW 2 154510581 missense probably damaging 1.00
R6842:Cbfa2t2 UTSW 2 154524045 missense probably benign 0.02
R6923:Cbfa2t2 UTSW 2 154534983 missense probably damaging 1.00
R7269:Cbfa2t2 UTSW 2 154515975 missense probably benign 0.37
R7318:Cbfa2t2 UTSW 2 154500454 missense probably benign 0.01
R7622:Cbfa2t2 UTSW 2 154500445 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25