Mutagenetix > Incidental Mutations

Incidental Mutation 'R2002:Abcb4'

223168

Institutional Source

Beutler Lab

Gene Symbol

Abcb4

Ensembl Gene

ENSMUSG00000042476

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 4

Synonyms

Pgy-2, Mdr2, Pgy2, mdr-2

MMRRC Submission

040012-MU

Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2002 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8893717-8959231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8905989 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 98 (S98T)

Ref Sequence

ENSEMBL: ENSMUSP00000142425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]

Predicted Effect

probably benign
Transcript: ENSMUST00000003717
AA Change: S98T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: S98T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	342	2e-94	PFAM
AAA	418	610	3.97e-20	SMART
Pfam:ABC_membrane	708	982	6.3e-77	PFAM
AAA	1058	1246	4.49e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196067
AA Change: S98T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: S98T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	344	2.4e-95	PFAM
AAA	418	610	6.2e-22	SMART
Pfam:ABC_membrane	708	882	1.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197458

Meta Mutation Damage Score

0.1211

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 91.6%

Validation Efficiency

97% (72/74)

MGI Phenotype

Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548G14Rik	T	C	15: 46,625,606		noncoding transcript	Het
Acan	T	C	7: 79,100,793	S1771P	probably damaging	Het
Acvr1c	T	A	2: 58,315,975	Q41L	probably benign	Het
Ak2	T	A	4: 129,008,229	S232T	probably benign	Het
Akr1e1	T	A	13: 4,607,565		probably benign	Het
Ano7	T	C	1: 93,400,581		probably benign	Het
Aox1	T	A	1: 58,047,141	H68Q	possibly damaging	Het
Apaf1	A	G	10: 91,061,814	V269A	possibly damaging	Het
Apba2	A	T	7: 64,733,542	I368F	probably damaging	Het
Armc3	A	G	2: 19,288,936	M513V	probably benign	Het
Asb5	G	A	8: 54,583,620	V116M	probably damaging	Het
Atg16l2	A	G	7: 101,294,920	S280P	possibly damaging	Het
Atp6v0c	G	T	17: 24,164,861	T40K	probably damaging	Het
C330027C09Rik	T	C	16: 49,005,851		probably benign	Het
Cdk2ap2	A	G	19: 4,097,903	M57V	possibly damaging	Het
Ctnnd1	T	C	2: 84,620,360	N172S	probably benign	Het
Ddx55	T	A	5: 124,566,440	V370E	probably damaging	Het
Ddx6	A	G	9: 44,607,534	T48A	probably benign	Het
Dnah10	C	T	5: 124,833,988	R4490W	probably damaging	Het
Dspp	T	A	5: 104,178,559	S929R	unknown	Het
Erbb3	T	C	10: 128,586,225	Y50C	probably benign	Het
Fam209	C	A	2: 172,472,769	N59K	probably benign	Het
Fgd3	T	C	13: 49,296,455	E106G	probably benign	Het
Frmd4a	A	C	2: 4,572,365	K344T	probably damaging	Het
Gbe1	A	G	16: 70,528,926	E617G	probably damaging	Het
Gm5089	T	A	14: 122,436,274	I12F	unknown	Het
Gm7052	T	A	17: 22,039,939		probably benign	Het
Gria1	A	T	11: 57,012,104	N24I	possibly damaging	Het
Grin2b	T	C	6: 135,733,245	E1101G	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Kcnma1	A	C	14: 23,337,029	S982A	probably damaging	Het
Khdrbs3	T	A	15: 69,013,479		probably benign	Het
Kif23	A	T	9: 61,927,384	C426*	probably null	Het
Lmo7	G	T	14: 101,887,061	A319S	probably benign	Het
Ly6c1	T	A	15: 75,048,493	T7S	possibly damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Mamdc4	A	T	2: 25,567,232	W548R	probably damaging	Het
Mfsd2a	C	T	4: 122,956,816	R88Q	probably damaging	Het
Mkrn1	T	C	6: 39,405,803	T158A	probably benign	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Mycbp2	A	G	14: 103,248,403	V1041A	probably damaging	Het
Ncam2	A	T	16: 81,589,698	H655L	possibly damaging	Het
Npas2	T	C	1: 39,338,195	V546A	probably benign	Het
Nrxn3	G	A	12: 90,332,315	A400T	probably damaging	Het
Olfr1020	T	A	2: 85,850,400	V316E	probably benign	Het
Olfr1066	T	C	2: 86,455,473	H266R	probably benign	Het
Olfr139	A	T	11: 74,045,039	S78R	possibly damaging	Het
Oog3	G	T	4: 144,158,105	H420Q	possibly damaging	Het
Pak7	T	A	2: 136,116,637	H177L	probably benign	Het
Pcca	A	G	14: 122,887,065	I683V	probably benign	Het
Pea15a	T	C	1: 172,198,685	I90V	probably benign	Het
Plagl1	C	A	10: 13,128,658		probably benign	Het
Prmt1	A	G	7: 44,978,724	V237A	probably damaging	Het
Ptprz1	T	A	6: 23,027,834	Y910*	probably null	Het
Rasal3	T	A	17: 32,393,611	T757S	probably damaging	Het
Rbbp8	T	C	18: 11,727,166		probably benign	Het
S1pr1	A	G	3: 115,712,895	S17P	probably benign	Het
Scel	G	A	14: 103,541,985	V131M	probably damaging	Het
Scn2a	G	A	2: 65,682,083	R188Q	probably null	Het
Snap29	T	A	16: 17,406,326	Y68*	probably null	Het
Spdl1	T	C	11: 34,822,646	T199A	probably benign	Het
Srbd1	T	C	17: 86,142,400	N14D	probably benign	Het
Ston1	G	A	17: 88,635,529	G121D	probably benign	Het
Syt16	G	A	12: 74,235,203	G367E	possibly damaging	Het
Tdpoz1	T	C	3: 93,671,403	T25A	possibly damaging	Het
Tmem182	T	A	1: 40,806,195	Y77N	probably damaging	Het
Tmprss11f	A	T	5: 86,539,768		probably benign	Het
Trp73	T	C	4: 154,081,445	T56A	probably damaging	Het
Trpm3	A	G	19: 22,982,583	K1194R	probably damaging	Het
Ttc39c	T	A	18: 12,697,878		probably null	Het
Ube4b	T	C	4: 149,383,797	D174G	probably benign	Het
Vmn1r211	A	T	13: 22,851,783	M238K	probably damaging	Het
Wsb2	T	A	5: 117,370,733	N77K	probably benign	Het
Xkr4	C	T	1: 3,671,095	R85Q	probably benign	Het
Zmynd11	T	A	13: 9,689,478		probably null	Het

Other mutations in Abcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Abcb4	APN	5	8950073	missense	probably benign	0.02
IGL00663:Abcb4	APN	5	8927916	missense	probably damaging	1.00
IGL00671:Abcb4	APN	5	8930745	nonsense	probably null
IGL00822:Abcb4	APN	5	8950046	missense	probably benign
IGL01080:Abcb4	APN	5	8934258	missense	probably damaging	1.00
IGL01152:Abcb4	APN	5	8950678	missense	probably benign	0.19
IGL01329:Abcb4	APN	5	8894166	critical splice donor site	probably null
IGL01483:Abcb4	APN	5	8927871	missense	probably damaging	0.99
IGL01594:Abcb4	APN	5	8946071	unclassified	probably null
IGL01785:Abcb4	APN	5	8915058	nonsense	probably null
IGL01968:Abcb4	APN	5	8927913	missense	probably benign	0.33
IGL02579:Abcb4	APN	5	8955537	missense	probably damaging	1.00
IGL02654:Abcb4	APN	5	8927826	missense	possibly damaging	0.80
IGL02658:Abcb4	APN	5	8934240	missense	probably benign
IGL03229:Abcb4	APN	5	8940936	missense	probably damaging	0.97
IGL03335:Abcb4	APN	5	8935258	missense	probably benign	0.00
FR4737:Abcb4	UTSW	5	8896597	small deletion	probably benign
P0014:Abcb4	UTSW	5	8950083	missense	probably benign	0.01
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0309:Abcb4	UTSW	5	8939835	missense	probably damaging	1.00
R0311:Abcb4	UTSW	5	8934243	missense	probably benign
R0420:Abcb4	UTSW	5	8941050	missense	probably benign	0.03
R0449:Abcb4	UTSW	5	8939885	nonsense	probably null
R0609:Abcb4	UTSW	5	8947376	missense	probably damaging	0.96
R1459:Abcb4	UTSW	5	8918662	missense	possibly damaging	0.61
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1812:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R1944:Abcb4	UTSW	5	8930796	missense	probably damaging	1.00
R2256:Abcb4	UTSW	5	8958431	missense	probably damaging	1.00
R3116:Abcb4	UTSW	5	8896610	missense	possibly damaging	0.86
R4112:Abcb4	UTSW	5	8936783	critical splice acceptor site	probably null
R4354:Abcb4	UTSW	5	8918771	missense	probably benign	0.44
R4512:Abcb4	UTSW	5	8928573	missense	probably damaging	1.00
R4588:Abcb4	UTSW	5	8947328	missense	probably benign	0.01
R4628:Abcb4	UTSW	5	8907399	missense	probably benign	0.08
R4708:Abcb4	UTSW	5	8915125	missense	possibly damaging	0.90
R4714:Abcb4	UTSW	5	8930906	splice site	probably null
R4754:Abcb4	UTSW	5	8910717	missense	probably damaging	1.00
R4846:Abcb4	UTSW	5	8935180	missense	probably benign
R4896:Abcb4	UTSW	5	8907267	missense	possibly damaging	0.81
R4944:Abcb4	UTSW	5	8934327	critical splice donor site	probably null
R4994:Abcb4	UTSW	5	8928524	missense	probably damaging	1.00
R5022:Abcb4	UTSW	5	8909054	intron	probably null
R5537:Abcb4	UTSW	5	8955485	missense	probably damaging	0.98
R5754:Abcb4	UTSW	5	8934320	missense	probably benign
R5833:Abcb4	UTSW	5	8958314	missense	probably damaging	1.00
R5934:Abcb4	UTSW	5	8930806	missense	probably benign	0.18
R6006:Abcb4	UTSW	5	8946026	missense	probably damaging	0.99
R6146:Abcb4	UTSW	5	8896587	missense	probably benign	0.05
R6183:Abcb4	UTSW	5	8918718	missense	probably benign
R6260:Abcb4	UTSW	5	8934219	nonsense	probably null
R6561:Abcb4	UTSW	5	8927825	missense	probably benign	0.14
R7016:Abcb4	UTSW	5	8936843	missense	probably benign	0.35
R7081:Abcb4	UTSW	5	8934263	missense	probably benign
R7326:Abcb4	UTSW	5	8934226	missense	probably benign	0.00
R7375:Abcb4	UTSW	5	8918671	missense	probably benign
R7787:Abcb4	UTSW	5	8909220	missense	probably damaging	1.00
R7836:Abcb4	UTSW	5	8934203	missense	probably benign
R7919:Abcb4	UTSW	5	8934203	missense	probably benign
RF015:Abcb4	UTSW	5	8896594	frame shift	probably null
RF047:Abcb4	UTSW	5	8896595	frame shift	probably null
Z1176:Abcb4	UTSW	5	8959005	missense	not run
Z1177:Abcb4	UTSW	5	8939906	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCGACACACTTGCAACTGTG -3'
(R):5'- AAGCAACTTTCTTGAAACTGGG -3'

Sequencing Primer
(F):5'- GTGTTTCAGTGAACTTAAAAGTACCC -3'
(R):5'- CAACTTTCTTGAAACTGGGGGCTG -3'

Posted On

2014-08-25