Incidental Mutation 'R2017:Svep1'
ID223175
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Namesushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
SynonymsD430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik
MMRRC Submission 040026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location58042442-58206859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58070568 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2406 (L2406P)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
Predicted Effect probably benign
Transcript: ENSMUST00000042850
AA Change: L2406P

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: L2406P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58176077 missense probably damaging 0.98
IGL00489:Svep1 APN 4 58068988 missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58069001 missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58068533 nonsense probably null
IGL00904:Svep1 APN 4 58097398 missense probably benign 0.00
IGL00935:Svep1 APN 4 58090664 missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58072791 nonsense probably null
IGL01077:Svep1 APN 4 58068760 missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58111419 missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58070302 missense probably benign 0.04
IGL01161:Svep1 APN 4 58146569 missense probably damaging 0.96
IGL01360:Svep1 APN 4 58116554 missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58100878 critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58068552 missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58084872 missense probably damaging 1.00
IGL01636:Svep1 APN 4 58116622 missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58121910 missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58176006 missense probably damaging 1.00
IGL01984:Svep1 APN 4 58068877 missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58069056 missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58088245 missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58123980 critical splice donor site probably null
IGL02043:Svep1 APN 4 58068556 missense probably benign 0.19
IGL02073:Svep1 APN 4 58070104 missense probably benign 0.06
IGL02188:Svep1 APN 4 58068382 missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58070311 missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58072819 missense probably benign 0.32
IGL02323:Svep1 APN 4 58070236 nonsense probably null
IGL02440:Svep1 APN 4 58145293 missense probably benign 0.06
IGL02449:Svep1 APN 4 58070296 missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58145341 splice site probably benign
IGL02568:Svep1 APN 4 58135441 missense probably benign 0.42
IGL02625:Svep1 APN 4 58115807 missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58123223 missense probably damaging 1.00
IGL02818:Svep1 APN 4 58069804 missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58100871 missense probably benign
IGL02875:Svep1 APN 4 58082821 splice site probably benign
IGL02887:Svep1 APN 4 58145301 missense probably damaging 1.00
IGL03240:Svep1 APN 4 58048188 missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58133387 missense probably benign 0.06
IGL03264:Svep1 APN 4 58066422 splice site probably benign
IGL03288:Svep1 APN 4 58116532 missense probably benign 0.01
IGL03340:Svep1 APN 4 58111451 missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58070308 nonsense probably null
IGL03348:Svep1 APN 4 58113635 missense probably damaging 1.00
R0001:Svep1 UTSW 4 58066460 missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58099937 splice site probably benign
R0142:Svep1 UTSW 4 58118232 missense probably benign 0.33
R0147:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0148:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58069830 missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58089514 missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58070851 missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58179610 missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58096331 missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58072737 missense probably damaging 0.98
R0322:Svep1 UTSW 4 58057996 splice site probably benign
R0426:Svep1 UTSW 4 58073333 missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R0457:Svep1 UTSW 4 58118136 missense probably damaging 1.00
R0471:Svep1 UTSW 4 58054700 missense possibly damaging 0.85
R0555:Svep1 UTSW 4 58128858 missense possibly damaging 0.71
R0634:Svep1 UTSW 4 58070661 missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58073121 nonsense probably null
R0827:Svep1 UTSW 4 58053113 splice site probably benign
R1025:Svep1 UTSW 4 58087817 missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58094084 missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1161:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58066427 critical splice donor site probably null
R1282:Svep1 UTSW 4 58100032 missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58115754 missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58068740 missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1628:Svep1 UTSW 4 58107561 missense probably benign 0.00
R1712:Svep1 UTSW 4 58070629 missense probably benign 0.06
R1774:Svep1 UTSW 4 58146562 missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58073333 missense probably benign
R1829:Svep1 UTSW 4 58096310 missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58097292 missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58064170 critical splice donor site probably null
R2058:Svep1 UTSW 4 58084554 missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58206030 missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58138602 splice site probably benign
R2281:Svep1 UTSW 4 58082677 missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58135628 splice site probably null
R2763:Svep1 UTSW 4 58084061 missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58087845 missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58066542 missense probably benign 0.32
R3763:Svep1 UTSW 4 58084833 missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3829:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3830:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3910:Svep1 UTSW 4 58145156 critical splice donor site probably null
R3943:Svep1 UTSW 4 58084807 splice site probably null
R3944:Svep1 UTSW 4 58084807 splice site probably null
R4153:Svep1 UTSW 4 58089426 missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58069068 missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58046601 missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58138695 missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58069249 missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58068886 missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58068526 nonsense probably null
R4592:Svep1 UTSW 4 58084028 missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58091944 missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58072698 missense probably damaging 0.98
R4639:Svep1 UTSW 4 58082724 missense probably benign
R4700:Svep1 UTSW 4 58097323 missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58205869 missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58070752 missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58053212 missense probably benign 0.06
R4781:Svep1 UTSW 4 58070340 missense probably damaging 0.98
R4820:Svep1 UTSW 4 58082664 missense probably benign 0.27
R4896:Svep1 UTSW 4 58087751 missense probably benign 0.08
R4905:Svep1 UTSW 4 58069308 missense probably benign 0.00
R4910:Svep1 UTSW 4 58096276 missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58087778 missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58087751 missense probably benign 0.08
R5088:Svep1 UTSW 4 58120648 missense possibly damaging 0.73
R5112:Svep1 UTSW 4 58068610 nonsense probably null
R5185:Svep1 UTSW 4 58084534 missense probably damaging 0.99
R5302:Svep1 UTSW 4 58096183 missense possibly damaging 0.71
R5307:Svep1 UTSW 4 58072677 missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58121892 missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58072991 missense possibly damaging 0.51
R5384:Svep1 UTSW 4 58104545 missense possibly damaging 0.71
R5414:Svep1 UTSW 4 58206322 missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58044054 missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58049282 critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58057954 missense probably benign 0.32
R5618:Svep1 UTSW 4 58070537 missense probably benign
R5623:Svep1 UTSW 4 58091964 missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58072826 missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58096223 missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58099985 missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58116524 missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58084906 missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58069345 missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58070977 nonsense probably null
R6010:Svep1 UTSW 4 58115832 missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58072872 missense probably damaging 1.00
R6192:Svep1 UTSW 4 58104536 missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58128869 missense probably benign 0.32
R6234:Svep1 UTSW 4 58113458 intron probably null
R6326:Svep1 UTSW 4 58073045 missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58049169 missense probably damaging 1.00
R6418:Svep1 UTSW 4 58053126 missense probably benign 0.01
R6440:Svep1 UTSW 4 58116555 missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58100066 missense probably damaging 1.00
R6515:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R6738:Svep1 UTSW 4 58123180 missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58049146 missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58064275 missense probably benign 0.01
R7055:Svep1 UTSW 4 58064275 missense probably benign 0.19
R7055:Svep1 UTSW 4 58120642 missense probably benign 0.33
R7111:Svep1 UTSW 4 58118207 missense possibly damaging 0.70
R7161:Svep1 UTSW 4 58128859 missense possibly damaging 0.93
R7162:Svep1 UTSW 4 58070262 missense possibly damaging 0.71
R7182:Svep1 UTSW 4 58043991 missense probably benign 0.18
R7292:Svep1 UTSW 4 58111395 missense possibly damaging 0.71
R7299:Svep1 UTSW 4 58046587 nonsense probably null
R7301:Svep1 UTSW 4 58046587 nonsense probably null
R7316:Svep1 UTSW 4 58068763 missense possibly damaging 0.71
R7337:Svep1 UTSW 4 58108323 missense probably damaging 0.98
R7391:Svep1 UTSW 4 58145185 missense probably damaging 0.98
R7402:Svep1 UTSW 4 58069699 missense possibly damaging 0.71
R7445:Svep1 UTSW 4 58094122 missense possibly damaging 0.85
R7450:Svep1 UTSW 4 58064248 missense possibly damaging 0.71
R7492:Svep1 UTSW 4 58066468 missense possibly damaging 0.51
R7505:Svep1 UTSW 4 58115862 missense possibly damaging 0.53
R7509:Svep1 UTSW 4 58090683 missense probably benign 0.40
R7538:Svep1 UTSW 4 58053260 missense possibly damaging 0.71
R7555:Svep1 UTSW 4 58069422 missense probably damaging 0.98
R7660:Svep1 UTSW 4 58087782 missense probably benign 0.32
R7670:Svep1 UTSW 4 58097424 missense probably damaging 1.00
R7719:Svep1 UTSW 4 58068523 missense probably damaging 0.97
R7733:Svep1 UTSW 4 58049239 missense probably benign 0.03
X0063:Svep1 UTSW 4 58070468 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGGGTGGTAGCATTGC -3'
(R):5'- CATTTCCTGTAAAGAGGGGCATG -3'

Sequencing Primer
(F):5'- GTGGTAGCATTGCCCACTAAC -3'
(R):5'- CTGTAAAGAGGGGCATGCCTTG -3'
Posted On2014-08-25