Incidental Mutation 'R0141:Cpt1c'
ID22318
Institutional Source Beutler Lab
Gene Symbol Cpt1c
Ensembl Gene ENSMUSG00000007783
Gene Namecarnitine palmitoyltransferase 1c
Synonyms9630004I06Rik, CPT I-C
MMRRC Submission 038426-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0141 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location44959372-44974851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44966671 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 306 (Y306H)
Ref Sequence ENSEMBL: ENSMUSP00000148815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063761] [ENSMUST00000211862] [ENSMUST00000212255] [ENSMUST00000212836]
Predicted Effect probably damaging
Transcript: ENSMUST00000063761
AA Change: Y306H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783
AA Change: Y306H

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207515
Predicted Effect probably benign
Transcript: ENSMUST00000211862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211901
Predicted Effect probably benign
Transcript: ENSMUST00000212255
Predicted Effect probably damaging
Transcript: ENSMUST00000212836
AA Change: Y306H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212890
Meta Mutation Damage Score 0.5295 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.9%
Validation Efficiency 88% (50/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein regulates the beta-oxidation and transport of long-chain fatty acids into mitochondria, and may play a role in the regulation of feeding behavior and whole-body energy homeostasis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted mutations in this gene result in reduced body weight, increases in circulating fatty acid levels and mild insulin resistance. Mice homozygous for a different targeted knock-out exhibit reduced ceramide levels, impaired dendritic spine maturationand impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik A T 1: 26,683,782 N772K probably benign Het
Acot12 A C 13: 91,771,828 D294A probably benign Het
Adamts9 T C 6: 92,943,085 D24G probably benign Het
Ahnak G A 19: 9,006,680 G1776D probably damaging Het
Arfgef3 C A 10: 18,597,407 C1636F probably damaging Het
AW551984 A G 9: 39,590,644 L722P probably damaging Het
Ccndbp1 T A 2: 121,012,422 M188K probably damaging Het
Col27a1 A T 4: 63,265,633 probably null Het
Cyp3a57 A G 5: 145,362,102 I71V probably benign Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dmrt2 A T 19: 25,678,291 Q418L possibly damaging Het
Ebf1 T C 11: 44,908,000 L284S probably damaging Het
Fam131a G A 16: 20,698,988 A15T probably benign Het
Fbxo17 A G 7: 28,733,491 T146A possibly damaging Het
Fer1l6 A G 15: 58,558,402 E226G probably damaging Het
Galnt18 A T 7: 111,599,031 I174N probably damaging Het
Gm13088 T C 4: 143,654,568 Y295C probably benign Het
Gm44501 T C 17: 40,578,853 I86T probably benign Het
Gm884 A C 11: 103,613,686 I2485M probably damaging Het
Gtsf1l T C 2: 163,087,326 Q79R probably benign Het
Hapln4 T C 8: 70,088,280 L321P probably damaging Het
Herc2 A G 7: 56,121,561 T1024A probably benign Het
Hps5 A G 7: 46,789,181 S43P probably damaging Het
Igsf10 A G 3: 59,330,832 Y643H probably damaging Het
Lama4 G A 10: 39,092,278 R1472H probably benign Het
Lhx9 A G 1: 138,840,006 Y73H possibly damaging Het
Loxl1 T A 9: 58,312,132 Q252L probably damaging Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Nr3c2 T A 8: 76,908,408 V46D probably damaging Het
Olfr1283 T A 2: 111,369,490 I286N probably damaging Het
Olfr152 C G 2: 87,782,705 P55R possibly damaging Het
Olfr487 A C 7: 108,212,003 N175K possibly damaging Het
Olfr495 A T 7: 108,395,368 N83Y probably benign Het
Olfr749 T C 14: 50,736,383 S260G possibly damaging Het
Osbp T C 19: 11,973,859 V256A possibly damaging Het
Pclo A T 5: 14,791,922 D4737V unknown Het
Pkdrej A G 15: 85,815,630 I2035T probably damaging Het
Plek2 A G 12: 78,894,504 S185P probably damaging Het
Pnpla6 G T 8: 3,532,117 probably null Het
Pou3f2 T C 4: 22,487,210 T308A possibly damaging Het
Pxmp4 A G 2: 154,592,295 V82A probably damaging Het
Rnf6 A T 5: 146,211,835 N135K possibly damaging Het
Rtl1 A G 12: 109,592,948 V819A probably damaging Het
Scn1a C A 2: 66,289,062 V1355L probably damaging Het
Scn2a T A 2: 65,711,816 N754K probably benign Het
Serpina3b A T 12: 104,130,771 N104Y probably damaging Het
Sh3rf2 T C 18: 42,156,057 S648P probably benign Het
Slc17a6 G A 7: 51,669,067 V486I probably benign Het
Syne2 T G 12: 75,941,298 D1743E probably damaging Het
Tex14 T G 11: 87,493,031 probably null Het
Tfb1m T C 17: 3,554,957 D87G probably damaging Het
Tll2 C T 19: 41,097,912 G609S probably damaging Het
Tsc22d2 A T 3: 58,417,156 probably benign Het
Tsen2 A G 6: 115,568,829 D360G probably damaging Het
Ugt2b37 G A 5: 87,240,983 P457L probably damaging Het
Vmn1r68 T C 7: 10,527,325 N282S possibly damaging Het
Vmn2r58 G A 7: 41,861,885 S498F probably benign Het
Zfp959 T C 17: 55,898,139 I392T probably benign Het
Other mutations in Cpt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Cpt1c APN 7 44960909 missense probably damaging 0.98
IGL01111:Cpt1c APN 7 44965554 missense possibly damaging 0.90
IGL01153:Cpt1c APN 7 44966668 missense probably damaging 0.99
IGL02232:Cpt1c APN 7 44960156 missense probably damaging 0.99
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0367:Cpt1c UTSW 7 44959575 missense probably benign
R0749:Cpt1c UTSW 7 44962826 missense probably damaging 1.00
R1384:Cpt1c UTSW 7 44960924 splice site probably benign
R1611:Cpt1c UTSW 7 44960112 missense probably benign 0.03
R3122:Cpt1c UTSW 7 44959921 missense probably damaging 1.00
R4892:Cpt1c UTSW 7 44959588 missense probably benign 0.14
R5175:Cpt1c UTSW 7 44971357 missense probably damaging 1.00
R6029:Cpt1c UTSW 7 44965124 missense probably benign 0.00
R6352:Cpt1c UTSW 7 44966795 critical splice donor site probably null
R6856:Cpt1c UTSW 7 44959918 missense probably damaging 1.00
R7621:Cpt1c UTSW 7 44967092 missense probably damaging 1.00
R7749:Cpt1c UTSW 7 44962265 missense probably benign 0.16
R7883:Cpt1c UTSW 7 44964014 splice site probably null
R8178:Cpt1c UTSW 7 44959653 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACCAATGTTACTCCGTCTCACTG -3'
(R):5'- CCTTTGCCACCAAGCAGGATTTTC -3'

Sequencing Primer
(F):5'- GTCTCACTGCGGAGGAAG -3'
(R):5'- CAAGCAGGATTTTCTGTACGTCAC -3'
Posted On2013-04-16