Incidental Mutation 'R2002:Atg16l2'
ID223203
Institutional Source Beutler Lab
Gene Symbol Atg16l2
Ensembl Gene ENSMUSG00000047767
Gene Nameautophagy related 16-like 2 (S. cerevisiae)
Synonyms2410118P20Rik
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2002 (G1)
Quality Score169
Status Validated
Chromosome7
Chromosomal Location101263034-101302251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101294920 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 280 (S280P)
Ref Sequence ENSEMBL: ENSMUSP00000117029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120267] [ENSMUST00000122116] [ENSMUST00000139609] [ENSMUST00000140553] [ENSMUST00000143630] [ENSMUST00000207121] [ENSMUST00000207740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120267
AA Change: S280P

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767
AA Change: S280P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122116
SMART Domains Protein: ENSMUSP00000113320
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 5.4e-14 PFAM
WD40 308 347 1.13e-7 SMART
WD40 352 391 6.79e-2 SMART
WD40 394 433 1.08e-4 SMART
WD40 436 472 2.97e0 SMART
WD40 475 513 1.61e-3 SMART
WD40 518 559 1.66e0 SMART
WD40 562 602 2.8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134531
Predicted Effect possibly damaging
Transcript: ENSMUST00000139609
AA Change: S280P

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117387
Gene: ENSMUSG00000047767
AA Change: S280P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140059
SMART Domains Protein: ENSMUSP00000119734
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
WD40 76 115 1.13e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140553
SMART Domains Protein: ENSMUSP00000116414
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143630
AA Change: S280P

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117029
Gene: ENSMUSG00000047767
AA Change: S280P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153327
Predicted Effect probably benign
Transcript: ENSMUST00000207121
Predicted Effect probably benign
Transcript: ENSMUST00000207740
Meta Mutation Damage Score 0.1396 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Atg16l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Atg16l2 APN 7 101300160 missense probably damaging 1.00
IGL00402:Atg16l2 APN 7 101296153 missense probably benign 0.00
IGL00662:Atg16l2 APN 7 101289896 missense probably benign 0.00
IGL00905:Atg16l2 APN 7 101300166 missense probably damaging 1.00
IGL01644:Atg16l2 APN 7 101297217 makesense probably null
IGL02839:Atg16l2 APN 7 101293397 missense probably damaging 1.00
R0316:Atg16l2 UTSW 7 101293396 missense probably damaging 1.00
R0638:Atg16l2 UTSW 7 101300110 critical splice donor site probably null
R0683:Atg16l2 UTSW 7 101290384 missense probably damaging 1.00
R1436:Atg16l2 UTSW 7 101291550 missense probably damaging 1.00
R1592:Atg16l2 UTSW 7 101291986 missense probably damaging 1.00
R1623:Atg16l2 UTSW 7 101289906 missense probably benign 0.01
R2090:Atg16l2 UTSW 7 101293368 splice site probably null
R2103:Atg16l2 UTSW 7 101290361 critical splice donor site probably null
R2349:Atg16l2 UTSW 7 101296539 missense probably damaging 0.96
R4738:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4739:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4740:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R5704:Atg16l2 UTSW 7 101300211 missense probably damaging 1.00
R6243:Atg16l2 UTSW 7 101292329 makesense probably null
R6257:Atg16l2 UTSW 7 101301895 splice site probably null
R6613:Atg16l2 UTSW 7 101290581 critical splice donor site probably null
R7331:Atg16l2 UTSW 7 101299048 missense probably damaging 1.00
R7349:Atg16l2 UTSW 7 101290266 missense probably damaging 1.00
R7719:Atg16l2 UTSW 7 101289867 missense probably damaging 1.00
R8186:Atg16l2 UTSW 7 101296507 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCACAGGTAGACAGGTACC -3'
(R):5'- AACTCTTGGTACCGTCTTGG -3'

Sequencing Primer
(F):5'- CACAGGTAGACAGGTACCAAAGGATG -3'
(R):5'- AGGTGTTCATTGCCAAGGTTCTC -3'
Posted On2014-08-25