Incidental Mutation 'R2017:Ascc3'
ID223231
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 040026-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50690211 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 751 (P751S)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably benign
Transcript: ENSMUST00000035606
AA Change: P751S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: P751S

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 intron probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
R7479:Ascc3 UTSW 10 50649799 missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50845700 missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R7921:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R8021:Ascc3 UTSW 10 50731648 missense not run
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50718421 missense not run
Predicted Primers PCR Primer
(F):5'- TGGTTTCCAGGCTGCTAGTAAG -3'
(R):5'- GTAAGCTGAATAAACCCTTTCCTC -3'

Sequencing Primer
(F):5'- CCAGGCTGCTAGTAAGTTTCATC -3'
(R):5'- GTTTCCATCATAGAAAGTGAAACTCC -3'
Posted On2014-08-25