Incidental Mutation 'R2002:Zmynd11'
ID223232
Institutional Source Beutler Lab
Gene Symbol Zmynd11
Ensembl Gene ENSMUSG00000021156
Gene Namezinc finger, MYND domain containing 11
Synonyms2210402G22Rik
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R2002 (G1)
Quality Score209
Status Validated
Chromosome13
Chromosomal Location9684833-9765330 bp(-) (GRCm38)
Type of Mutationsplice site (54 bp from exon)
DNA Base Change (assembly) T to A at 9689478 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062658] [ENSMUST00000110633] [ENSMUST00000110634] [ENSMUST00000110635] [ENSMUST00000110636] [ENSMUST00000110637] [ENSMUST00000110638] [ENSMUST00000130151] [ENSMUST00000157035] [ENSMUST00000220996] [ENSMUST00000222475] [ENSMUST00000223421]
Predicted Effect probably null
Transcript: ENSMUST00000062658
AA Change: R438*
SMART Domains Protein: ENSMUSP00000059767
Gene: ENSMUSG00000021156
AA Change: R438*

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110633
AA Change: R508*
SMART Domains Protein: ENSMUSP00000106263
Gene: ENSMUSG00000021156
AA Change: R508*

DomainStartEndE-ValueType
PHD 62 106 4.19e-7 SMART
RING 66 105 8.31e-1 SMART
BROMO 111 217 1.03e-18 SMART
PWWP 238 289 1.96e-21 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
coiled coil region 503 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110634
AA Change: R492*
SMART Domains Protein: ENSMUSP00000106264
Gene: ENSMUSG00000021156
AA Change: R492*

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110635
AA Change: R461*
SMART Domains Protein: ENSMUSP00000106265
Gene: ENSMUSG00000021156
AA Change: R461*

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 133 226 3.35e-4 SMART
PWWP 247 298 1.96e-21 SMART
low complexity region 341 354 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
coiled coil region 456 496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110636
AA Change: R492*
SMART Domains Protein: ENSMUSP00000106266
Gene: ENSMUSG00000021156
AA Change: R492*

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110637
AA Change: R438*
SMART Domains Protein: ENSMUSP00000106267
Gene: ENSMUSG00000021156
AA Change: R438*

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110638
AA Change: R494*
SMART Domains Protein: ENSMUSP00000106268
Gene: ENSMUSG00000021156
AA Change: R494*

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
coiled coil region 489 529 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130151
SMART Domains Protein: ENSMUSP00000118964
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 117 161 4.19e-7 SMART
RING 121 160 8.31e-1 SMART
BROMO 166 272 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138039
Predicted Effect probably benign
Transcript: ENSMUST00000157035
Predicted Effect probably benign
Transcript: ENSMUST00000220996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222038
Predicted Effect probably null
Transcript: ENSMUST00000222475
AA Change: R407*
Predicted Effect probably null
Transcript: ENSMUST00000223421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222446
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Trpm3 A G 19: 22,982,583 K1194R probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Other mutations in Zmynd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zmynd11 APN 13 9689226 missense probably damaging 0.97
IGL00846:Zmynd11 APN 13 9720772 critical splice donor site probably null
IGL01606:Zmynd11 APN 13 9697688 missense probably damaging 1.00
IGL03229:Zmynd11 APN 13 9689565 missense probably damaging 1.00
R1173:Zmynd11 UTSW 13 9689549 missense probably damaging 1.00
R1413:Zmynd11 UTSW 13 9710220 missense probably damaging 1.00
R1813:Zmynd11 UTSW 13 9689580 missense possibly damaging 0.53
R1872:Zmynd11 UTSW 13 9698701 missense possibly damaging 0.88
R2991:Zmynd11 UTSW 13 9695822 missense probably damaging 0.99
R4273:Zmynd11 UTSW 13 9697690 missense probably damaging 1.00
R4708:Zmynd11 UTSW 13 9695753 missense probably damaging 0.97
R4718:Zmynd11 UTSW 13 9689567 missense possibly damaging 0.86
R5011:Zmynd11 UTSW 13 9689443 unclassified probably benign
R5151:Zmynd11 UTSW 13 9690917 missense probably damaging 1.00
R5963:Zmynd11 UTSW 13 9695895 intron probably benign
R6648:Zmynd11 UTSW 13 9713021 missense probably benign 0.11
R7002:Zmynd11 UTSW 13 9694330 missense probably damaging 1.00
R7223:Zmynd11 UTSW 13 9710162 missense probably benign 0.09
R7322:Zmynd11 UTSW 13 9690409 missense possibly damaging 0.53
R7462:Zmynd11 UTSW 13 9698684 missense probably benign 0.29
R7500:Zmynd11 UTSW 13 9735398 missense probably benign 0.00
R7737:Zmynd11 UTSW 13 9695139 missense probably damaging 1.00
R8181:Zmynd11 UTSW 13 9689651 missense probably benign 0.08
R8331:Zmynd11 UTSW 13 9695154 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GACAGCGACAGATCAGATCC -3'
(R):5'- TTGAGAGGGTGTCAGTGTCAAC -3'

Sequencing Primer
(F):5'- ATAGACAAGGCCTCACTGCTGG -3'
(R):5'- GTGTCAGTGTCAACCCAGAC -3'
Posted On2014-08-25