Incidental Mutation 'R2017:Nle1'
ID223255
Institutional Source Beutler Lab
Gene Symbol Nle1
Ensembl Gene ENSMUSG00000020692
Gene Namenotchless homolog 1
Synonymsnotchless, Nle, l11Jus4, l11Jus1
MMRRC Submission 040026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82900768-82908411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 82905547 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 166 (P166Q)
Ref Sequence ENSEMBL: ENSMUSP00000099502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018988] [ENSMUST00000103213]
Predicted Effect probably benign
Transcript: ENSMUST00000018988
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103213
AA Change: P166Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692
AA Change: P166Q

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124109
Predicted Effect probably benign
Transcript: ENSMUST00000126202
SMART Domains Protein: ENSMUSP00000130605
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
SCOP:d1flga_ 12 46 2e-5 SMART
Blast:WD40 22 48 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147915
Predicted Effect probably benign
Transcript: ENSMUST00000167196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170815
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation, most blastocysts fail to hatch out of the zona pellucida, and apoptosis is increased in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Nle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nle1 APN 11 82904307 nonsense probably null
IGL02945:Nle1 APN 11 82904084 splice site probably benign
IGL03170:Nle1 APN 11 82904270 missense probably benign
R0401:Nle1 UTSW 11 82905379 unclassified probably benign
R0646:Nle1 UTSW 11 82904845 missense probably damaging 1.00
R1958:Nle1 UTSW 11 82904242 missense probably benign 0.01
R1966:Nle1 UTSW 11 82901788 missense probably damaging 1.00
R2016:Nle1 UTSW 11 82905547 missense probably damaging 1.00
R2049:Nle1 UTSW 11 82905366 missense probably damaging 1.00
R2140:Nle1 UTSW 11 82905568 missense probably damaging 0.99
R2289:Nle1 UTSW 11 82903053 missense probably benign 0.01
R4354:Nle1 UTSW 11 82906431 missense possibly damaging 0.65
R4963:Nle1 UTSW 11 82904937 missense probably benign 0.04
R4964:Nle1 UTSW 11 82908192 missense probably damaging 1.00
R5257:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5258:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5509:Nle1 UTSW 11 82903182 missense possibly damaging 0.92
R6160:Nle1 UTSW 11 82908157 missense probably benign 0.01
R7206:Nle1 UTSW 11 82904931 missense probably benign 0.35
R7696:Nle1 UTSW 11 82904966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGATCCATTTGCTGTGGCC -3'
(R):5'- ACTAGGGAGTGGCAGTGTTATC -3'

Sequencing Primer
(F):5'- TTGGGTCCCACAGCAGAAC -3'
(R):5'- CAGTGTTATCTGCAGAAAGCTG -3'
Posted On2014-08-25