Incidental Mutation 'R2017:Epx'
ID223257
Institutional Source Beutler Lab
Gene Symbol Epx
Ensembl Gene ENSMUSG00000052234
Gene Nameeosinophil peroxidase
SynonymsEPO
MMRRC Submission 040026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87864000-87875536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87874337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 178 (D178G)
Ref Sequence ENSEMBL: ENSMUSP00000050497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049768]
Predicted Effect probably damaging
Transcript: ENSMUST00000049768
AA Change: D178G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050497
Gene: ENSMUSG00000052234
AA Change: D178G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 146 690 8.3e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125590
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peroxidase superfamily of enzymes that is produced by eosinophils and plays a critical role in eliminating tissue-invasive parasites. The encoded preproprotein undergoes proteolytic processing to generate a heterodimeric enzyme that forms a predominant component of the intracellular granules of eosinophils. Mice lacking the encoded protein exhibit resistance to ulcerative colitis induced by dextran sulfate. [provided by RefSeq, Jul 2016]
PHENOTYPE: Targeted deletion of this gene results in ultrastructural changes of the eosinophil secondary granule but does not significantly alter the course of inflammation or development of allergic pulmonary pathologies in an ovalbumin-challenge model of pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Epx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Epx APN 11 87869925 missense probably damaging 1.00
IGL01723:Epx APN 11 87869402 missense probably damaging 1.00
IGL02096:Epx APN 11 87869468 missense probably damaging 1.00
IGL02423:Epx APN 11 87871318 missense possibly damaging 0.85
K7371:Epx UTSW 11 87864884 missense probably damaging 1.00
R1018:Epx UTSW 11 87869303 missense probably benign 0.05
R1607:Epx UTSW 11 87868712 missense probably damaging 1.00
R2030:Epx UTSW 11 87864824 missense probably damaging 1.00
R3838:Epx UTSW 11 87874830 missense probably damaging 1.00
R4417:Epx UTSW 11 87869430 nonsense probably null
R5083:Epx UTSW 11 87872680 missense probably damaging 0.99
R5712:Epx UTSW 11 87874853 nonsense probably null
R5935:Epx UTSW 11 87865492 missense probably damaging 1.00
R6830:Epx UTSW 11 87868626 missense probably damaging 1.00
R6857:Epx UTSW 11 87869955 nonsense probably null
R6984:Epx UTSW 11 87868598 missense probably damaging 1.00
R7031:Epx UTSW 11 87875523 start gained probably benign
R7652:Epx UTSW 11 87875334 critical splice donor site probably null
R7667:Epx UTSW 11 87874311 missense probably damaging 0.98
X0065:Epx UTSW 11 87865475 missense probably benign 0.03
Z1177:Epx UTSW 11 87869261 missense probably damaging 1.00
Z1177:Epx UTSW 11 87869894 missense possibly damaging 0.56
Z1177:Epx UTSW 11 87872767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCAAGAACTTCACTTTCATTCAC -3'
(R):5'- GAGGTGCAGCAACAAGTACC -3'

Sequencing Primer
(F):5'- TTCACAGGTGAAGAAACTGGTCTC -3'
(R):5'- TACCGAACCATAACAGGGAGATGC -3'
Posted On2014-08-25