Incidental Mutation 'R2017:Jup'
ID223259
Institutional Source Beutler Lab
Gene Symbol Jup
Ensembl Gene ENSMUSG00000001552
Gene Namejunction plakoglobin
SynonymsPG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik
MMRRC Submission 040026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100368958-100397763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100386341 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 14 (T14S)
Ref Sequence ENSEMBL: ENSMUSP00000103026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]
Predicted Effect probably benign
Transcript: ENSMUST00000001592
AA Change: T14S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: T14S

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107403
AA Change: T14S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: T14S

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155746
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Jup
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Jup APN 11 100386249 missense probably benign
IGL01797:Jup APN 11 100381672 splice site probably benign
IGL01926:Jup APN 11 100383586 missense probably benign 0.00
IGL02030:Jup APN 11 100376991 missense probably damaging 0.96
IGL02073:Jup APN 11 100383389 splice site probably benign
IGL02218:Jup APN 11 100381839 missense probably damaging 1.00
IGL02450:Jup APN 11 100378357 missense probably damaging 1.00
IGL02955:Jup APN 11 100376739 missense probably benign 0.31
IGL02976:Jup APN 11 100378366 missense probably benign 0.40
IGL03023:Jup APN 11 100380692 splice site probably benign
IGL02802:Jup UTSW 11 100378378 missense probably benign
PIT4403001:Jup UTSW 11 100378087 critical splice donor site probably null
R0426:Jup UTSW 11 100372401 missense probably benign 0.02
R0626:Jup UTSW 11 100376763 missense probably benign
R1330:Jup UTSW 11 100372676 missense probably benign 0.02
R1437:Jup UTSW 11 100383576 missense probably benign 0.06
R1448:Jup UTSW 11 100383200 missense probably damaging 1.00
R1473:Jup UTSW 11 100379601 missense possibly damaging 0.79
R1686:Jup UTSW 11 100372434 missense probably damaging 0.96
R1824:Jup UTSW 11 100374137 nonsense probably null
R1875:Jup UTSW 11 100372294 unclassified probably null
R2989:Jup UTSW 11 100376841 missense possibly damaging 0.92
R3881:Jup UTSW 11 100378381 missense probably benign
R3882:Jup UTSW 11 100378381 missense probably benign
R4176:Jup UTSW 11 100372461 missense probably benign 0.03
R4612:Jup UTSW 11 100381834 missense probably damaging 0.98
R4808:Jup UTSW 11 100378192 missense probably damaging 0.99
R4854:Jup UTSW 11 100383041 missense possibly damaging 0.73
R4995:Jup UTSW 11 100379541 nonsense probably null
R5133:Jup UTSW 11 100383115 missense probably benign 0.02
R5408:Jup UTSW 11 100376781 missense probably damaging 1.00
R5641:Jup UTSW 11 100376806 missense possibly damaging 0.62
R5991:Jup UTSW 11 100379569 missense possibly damaging 0.59
R6431:Jup UTSW 11 100374341 missense probably benign 0.01
R6805:Jup UTSW 11 100383458 missense probably benign 0.17
R7022:Jup UTSW 11 100379553 missense probably damaging 1.00
R7203:Jup UTSW 11 100381734 missense probably damaging 1.00
R7399:Jup UTSW 11 100378351 missense possibly damaging 0.87
R7707:Jup UTSW 11 100383052 missense possibly damaging 0.90
R8019:Jup UTSW 11 100374197 missense probably benign 0.34
R8074:Jup UTSW 11 100386287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTTGGTTCTGTGGCAC -3'
(R):5'- TTAATGACCTTACTGCAGCCCTAC -3'

Sequencing Primer
(F):5'- CACCCCTTGTGTATAGGTGG -3'
(R):5'- TGTCTGCAACCCTCTGAGG -3'
Posted On2014-08-25