Incidental Mutation 'R2002:Trpm3'
ID223282
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Nametransient receptor potential cation channel, subfamily M, member 3
SynonymsB930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3
MMRRC Submission 040012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2002 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location22139119-22989884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22982583 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1194 (K1194R)
Ref Sequence ENSEMBL: ENSMUSP00000084857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]
Predicted Effect probably benign
Transcript: ENSMUST00000037901
AA Change: K1192R

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: K1192R

DomainStartEndE-ValueType
Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074770
AA Change: K1184R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: K1184R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087576
AA Change: K1194R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: K1194R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099569
AA Change: K1194R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: K1194R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,625,606 noncoding transcript Het
Abcb4 T A 5: 8,905,989 S98T probably benign Het
Acan T C 7: 79,100,793 S1771P probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Ak2 T A 4: 129,008,229 S232T probably benign Het
Akr1e1 T A 13: 4,607,565 probably benign Het
Ano7 T C 1: 93,400,581 probably benign Het
Aox1 T A 1: 58,047,141 H68Q possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Apba2 A T 7: 64,733,542 I368F probably damaging Het
Armc3 A G 2: 19,288,936 M513V probably benign Het
Asb5 G A 8: 54,583,620 V116M probably damaging Het
Atg16l2 A G 7: 101,294,920 S280P possibly damaging Het
Atp6v0c G T 17: 24,164,861 T40K probably damaging Het
C330027C09Rik T C 16: 49,005,851 probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Ddx55 T A 5: 124,566,440 V370E probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dnah10 C T 5: 124,833,988 R4490W probably damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Erbb3 T C 10: 128,586,225 Y50C probably benign Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Fgd3 T C 13: 49,296,455 E106G probably benign Het
Frmd4a A C 2: 4,572,365 K344T probably damaging Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gm5089 T A 14: 122,436,274 I12F unknown Het
Gm7052 T A 17: 22,039,939 probably benign Het
Gria1 A T 11: 57,012,104 N24I possibly damaging Het
Grin2b T C 6: 135,733,245 E1101G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Kcnma1 A C 14: 23,337,029 S982A probably damaging Het
Khdrbs3 T A 15: 69,013,479 probably benign Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lmo7 G T 14: 101,887,061 A319S probably benign Het
Ly6c1 T A 15: 75,048,493 T7S possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mamdc4 A T 2: 25,567,232 W548R probably damaging Het
Mfsd2a C T 4: 122,956,816 R88Q probably damaging Het
Mkrn1 T C 6: 39,405,803 T158A probably benign Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Mycbp2 A G 14: 103,248,403 V1041A probably damaging Het
Ncam2 A T 16: 81,589,698 H655L possibly damaging Het
Npas2 T C 1: 39,338,195 V546A probably benign Het
Nrxn3 G A 12: 90,332,315 A400T probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr139 A T 11: 74,045,039 S78R possibly damaging Het
Oog3 G T 4: 144,158,105 H420Q possibly damaging Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pcca A G 14: 122,887,065 I683V probably benign Het
Pea15a T C 1: 172,198,685 I90V probably benign Het
Plagl1 C A 10: 13,128,658 probably benign Het
Prmt1 A G 7: 44,978,724 V237A probably damaging Het
Ptprz1 T A 6: 23,027,834 Y910* probably null Het
Rasal3 T A 17: 32,393,611 T757S probably damaging Het
Rbbp8 T C 18: 11,727,166 probably benign Het
S1pr1 A G 3: 115,712,895 S17P probably benign Het
Scel G A 14: 103,541,985 V131M probably damaging Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Snap29 T A 16: 17,406,326 Y68* probably null Het
Spdl1 T C 11: 34,822,646 T199A probably benign Het
Srbd1 T C 17: 86,142,400 N14D probably benign Het
Ston1 G A 17: 88,635,529 G121D probably benign Het
Syt16 G A 12: 74,235,203 G367E possibly damaging Het
Tdpoz1 T C 3: 93,671,403 T25A possibly damaging Het
Tmem182 T A 1: 40,806,195 Y77N probably damaging Het
Tmprss11f A T 5: 86,539,768 probably benign Het
Trp73 T C 4: 154,081,445 T56A probably damaging Het
Ttc39c T A 18: 12,697,878 probably null Het
Ube4b T C 4: 149,383,797 D174G probably benign Het
Vmn1r211 A T 13: 22,851,783 M238K probably damaging Het
Wsb2 T A 5: 117,370,733 N77K probably benign Het
Xkr4 C T 1: 3,671,095 R85Q probably benign Het
Zmynd11 T A 13: 9,689,478 probably null Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22987659 missense probably benign 0.00
IGL00773:Trpm3 APN 19 22900159 missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22987071 missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22715246 missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22987127 missense probably benign 0.01
IGL01818:Trpm3 APN 19 22914474 missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22711719 missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22902069 nonsense probably null
IGL02324:Trpm3 APN 19 22698779 missense probably benign 0.25
IGL02947:Trpm3 APN 19 22901119 missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22889412 missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22914465 missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22926071 critical splice donor site probably null
IGL03354:Trpm3 APN 19 22856718 missense probably damaging 1.00
bit UTSW 19 22987869 missense probably benign 0.00
P0041:Trpm3 UTSW 19 22897686 missense probably benign 0.01
R0001:Trpm3 UTSW 19 22715331 missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0007:Trpm3 UTSW 19 22987529 missense probably benign 0.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22914446 missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22987916 missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22715356 splice site probably null
R0268:Trpm3 UTSW 19 22897521 critical splice donor site probably null
R0299:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22988054 missense probably benign
R0481:Trpm3 UTSW 19 22901071 missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22698778 missense probably benign 0.00
R0499:Trpm3 UTSW 19 22986873 missense possibly damaging 0.62
R0550:Trpm3 UTSW 19 22987812 missense probably damaging 0.97
R0729:Trpm3 UTSW 19 22987789 missense probably benign
R0883:Trpm3 UTSW 19 22978654 missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22988043 missense probably benign 0.02
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1185:Trpm3 UTSW 19 22914417 splice site probably benign
R1513:Trpm3 UTSW 19 22986872 missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22901221 missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22978334 missense probably benign 0.39
R1569:Trpm3 UTSW 19 22889445 critical splice donor site probably null
R1598:Trpm3 UTSW 19 22733024 missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22139155 missense probably benign 0.00
R1616:Trpm3 UTSW 19 22982712 missense probably damaging 1.00
R1619:Trpm3 UTSW 19 22711907 missense probably damaging 0.99
R1923:Trpm3 UTSW 19 22885412 missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22926082 missense possibly damaging 0.56
R2249:Trpm3 UTSW 19 22733034 missense probably benign 0.15
R3719:Trpm3 UTSW 19 22986990 missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22448377 missense probably benign
R3774:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3774:Trpm3 UTSW 19 22987975 missense probably benign 0.03
R3776:Trpm3 UTSW 19 22978602 missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22987449 missense probably benign 0.00
R3899:Trpm3 UTSW 19 22901160 missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22987564 missense probably benign 0.00
R4238:Trpm3 UTSW 19 22978638 missense probably damaging 1.00
R4301:Trpm3 UTSW 19 22987292 missense probably benign 0.23
R4344:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4345:Trpm3 UTSW 19 22897697 missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22978330 missense probably benign 0.00
R4510:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4511:Trpm3 UTSW 19 22988017 missense probably benign 0.00
R4565:Trpm3 UTSW 19 22987869 missense probably benign 0.00
R4573:Trpm3 UTSW 19 22902142 missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22978624 missense probably benign 0.26
R4677:Trpm3 UTSW 19 22987388 missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22987781 missense probably benign
R4713:Trpm3 UTSW 19 22889435 missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22715295 missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22711712 missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22698766 missense probably benign 0.01
R5074:Trpm3 UTSW 19 22885349 missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22766756 missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22918766 missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22904714 missense probably benign 0.06
R5204:Trpm3 UTSW 19 22448341 nonsense probably null
R5213:Trpm3 UTSW 19 22697454 nonsense probably null
R5358:Trpm3 UTSW 19 22925968 missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22926184 nonsense probably null
R5382:Trpm3 UTSW 19 22885341 splice site probably null
R5509:Trpm3 UTSW 19 22987258 missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22987814 missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22910054 missense probably benign 0.01
R6433:Trpm3 UTSW 19 22901305 missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22926113 missense probably benign 0.04
R6630:Trpm3 UTSW 19 22987983 missense probably benign 0.00
R6640:Trpm3 UTSW 19 22978582 missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22926028 missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22978684 missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22902193 missense probably benign 0.27
R7467:Trpm3 UTSW 19 22978334 missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22978573 missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22897796 missense probably benign 0.28
R7600:Trpm3 UTSW 19 22926094 missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22918790 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTGTGGCTCAGGAAGAAGC -3'
(R):5'- TCCATGTTTTCTTGGGCAATAAAGC -3'

Sequencing Primer
(F):5'- CTCAGGAAGAAGCTGGTGATTC -3'
(R):5'- TGGAGATGTGAGAACAATTTAACTG -3'
Posted On2014-08-25