Incidental Mutation 'R2002:Trpm3'
ID 223282
Institutional Source Beutler Lab
Gene Symbol Trpm3
Ensembl Gene ENSMUSG00000052387
Gene Name transient receptor potential cation channel, subfamily M, member 3
Synonyms 6330504P12Rik, LTRPC3, melastatin 2, B930001P07Rik, MLSN2
MMRRC Submission 040012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R2002 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 22116410-22972774 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22959947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1194 (K1194R)
Ref Sequence ENSEMBL: ENSMUSP00000084857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]
AlphaFold J9S314
Predicted Effect probably benign
Transcript: ENSMUST00000037901
AA Change: K1192R

PolyPhen 2 Score 0.200 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: K1192R

DomainStartEndE-ValueType
Blast:ANK 485 514 1e-6 BLAST
low complexity region 619 631 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 788 800 N/A INTRINSIC
low complexity region 821 840 N/A INTRINSIC
Pfam:Ion_trans 883 1136 1.7e-19 PFAM
Pfam:TRPM_tetra 1227 1282 1.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074770
AA Change: K1184R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: K1184R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 611 623 N/A INTRINSIC
low complexity region 666 681 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 813 832 N/A INTRINSIC
transmembrane domain 874 896 N/A INTRINSIC
Pfam:Ion_trans 908 1116 5.1e-14 PFAM
low complexity region 1378 1388 N/A INTRINSIC
low complexity region 1433 1455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087576
AA Change: K1194R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: K1194R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 5e-7 BLAST
low complexity region 621 633 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 790 802 N/A INTRINSIC
low complexity region 823 842 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
Pfam:Ion_trans 918 1126 5.1e-14 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099569
AA Change: K1194R

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: K1194R

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
Blast:ANK 487 516 6e-7 BLAST
low complexity region 609 621 N/A INTRINSIC
low complexity region 664 679 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
Pfam:Ion_trans 873 1138 3.2e-19 PFAM
Pfam:TRPM_tetra 1229 1284 4.4e-26 PFAM
low complexity region 1388 1398 N/A INTRINSIC
low complexity region 1443 1465 N/A INTRINSIC
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.6%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik T C 15: 46,489,002 (GRCm39) noncoding transcript Het
Abcb4 T A 5: 8,955,989 (GRCm39) S98T probably benign Het
Acan T C 7: 78,750,541 (GRCm39) S1771P probably damaging Het
Acvr1c T A 2: 58,205,987 (GRCm39) Q41L probably benign Het
Ak2 T A 4: 128,902,022 (GRCm39) S232T probably benign Het
Akr1e1 T A 13: 4,657,564 (GRCm39) probably benign Het
Ano7 T C 1: 93,328,303 (GRCm39) probably benign Het
Aox1 T A 1: 58,086,300 (GRCm39) H68Q possibly damaging Het
Apaf1 A G 10: 90,897,676 (GRCm39) V269A possibly damaging Het
Apba2 A T 7: 64,383,290 (GRCm39) I368F probably damaging Het
Armc3 A G 2: 19,293,747 (GRCm39) M513V probably benign Het
Asb5 G A 8: 55,036,655 (GRCm39) V116M probably damaging Het
Atg16l2 A G 7: 100,944,127 (GRCm39) S280P possibly damaging Het
Atp6v0c G T 17: 24,383,835 (GRCm39) T40K probably damaging Het
Cdk2ap2 A G 19: 4,147,903 (GRCm39) M57V possibly damaging Het
Cip2a T C 16: 48,826,214 (GRCm39) probably benign Het
Ctnnd1 T C 2: 84,450,704 (GRCm39) N172S probably benign Het
Ddx55 T A 5: 124,704,503 (GRCm39) V370E probably damaging Het
Ddx6 A G 9: 44,518,831 (GRCm39) T48A probably benign Het
Dnah10 C T 5: 124,911,052 (GRCm39) R4490W probably damaging Het
Dspp T A 5: 104,326,425 (GRCm39) S929R unknown Het
Erbb3 T C 10: 128,422,094 (GRCm39) Y50C probably benign Het
Fam209 C A 2: 172,314,689 (GRCm39) N59K probably benign Het
Fgd3 T C 13: 49,449,931 (GRCm39) E106G probably benign Het
Frmd4a A C 2: 4,577,176 (GRCm39) K344T probably damaging Het
Gbe1 A G 16: 70,325,814 (GRCm39) E617G probably damaging Het
Gm5089 T A 14: 122,673,686 (GRCm39) I12F unknown Het
Gm7052 T A 17: 22,258,920 (GRCm39) probably benign Het
Gria1 A T 11: 56,902,930 (GRCm39) N24I possibly damaging Het
Grin2b T C 6: 135,710,243 (GRCm39) E1101G probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Kcnma1 A C 14: 23,387,097 (GRCm39) S982A probably damaging Het
Khdrbs3 T A 15: 68,885,328 (GRCm39) probably benign Het
Kif23 A T 9: 61,834,666 (GRCm39) C426* probably null Het
Lmo7 G T 14: 102,124,497 (GRCm39) A319S probably benign Het
Ly6c1 T A 15: 74,920,342 (GRCm39) T7S possibly damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Mamdc4 A T 2: 25,457,244 (GRCm39) W548R probably damaging Het
Mfsd2a C T 4: 122,850,609 (GRCm39) R88Q probably damaging Het
Mkrn1 T C 6: 39,382,737 (GRCm39) T158A probably benign Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Mycbp2 A G 14: 103,485,839 (GRCm39) V1041A probably damaging Het
Ncam2 A T 16: 81,386,586 (GRCm39) H655L possibly damaging Het
Npas2 T C 1: 39,377,276 (GRCm39) V546A probably benign Het
Nrxn3 G A 12: 90,299,089 (GRCm39) A400T probably damaging Het
Oog3 G T 4: 143,884,675 (GRCm39) H420Q possibly damaging Het
Or3a10 A T 11: 73,935,865 (GRCm39) S78R possibly damaging Het
Or5ap2 T A 2: 85,680,744 (GRCm39) V316E probably benign Het
Or8k28 T C 2: 86,285,817 (GRCm39) H266R probably benign Het
Pak5 T A 2: 135,958,557 (GRCm39) H177L probably benign Het
Pcca A G 14: 123,124,477 (GRCm39) I683V probably benign Het
Pea15a T C 1: 172,026,252 (GRCm39) I90V probably benign Het
Plagl1 C A 10: 13,004,402 (GRCm39) probably benign Het
Prmt1 A G 7: 44,628,148 (GRCm39) V237A probably damaging Het
Ptprz1 T A 6: 23,027,833 (GRCm39) Y910* probably null Het
Rasal3 T A 17: 32,612,585 (GRCm39) T757S probably damaging Het
Rbbp8 T C 18: 11,860,223 (GRCm39) probably benign Het
S1pr1 A G 3: 115,506,544 (GRCm39) S17P probably benign Het
Scel G A 14: 103,779,421 (GRCm39) V131M probably damaging Het
Scn2a G A 2: 65,512,427 (GRCm39) R188Q probably null Het
Snap29 T A 16: 17,224,190 (GRCm39) Y68* probably null Het
Spdl1 T C 11: 34,713,473 (GRCm39) T199A probably benign Het
Srbd1 T C 17: 86,449,828 (GRCm39) N14D probably benign Het
Ston1 G A 17: 88,942,957 (GRCm39) G121D probably benign Het
Syt16 G A 12: 74,281,977 (GRCm39) G367E possibly damaging Het
Tdpoz1 T C 3: 93,578,710 (GRCm39) T25A possibly damaging Het
Tmem182 T A 1: 40,845,355 (GRCm39) Y77N probably damaging Het
Tmprss11f A T 5: 86,687,627 (GRCm39) probably benign Het
Trp73 T C 4: 154,165,902 (GRCm39) T56A probably damaging Het
Ttc39c T A 18: 12,830,935 (GRCm39) probably null Het
Ube4b T C 4: 149,468,254 (GRCm39) D174G probably benign Het
Vmn1r211 A T 13: 23,035,953 (GRCm39) M238K probably damaging Het
Wsb2 T A 5: 117,508,798 (GRCm39) N77K probably benign Het
Xkr4 C T 1: 3,741,318 (GRCm39) R85Q probably benign Het
Zmynd11 T A 13: 9,739,514 (GRCm39) probably null Het
Other mutations in Trpm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Trpm3 APN 19 22,965,023 (GRCm39) missense probably benign 0.00
IGL00773:Trpm3 APN 19 22,877,523 (GRCm39) missense possibly damaging 0.92
IGL00852:Trpm3 APN 19 22,964,435 (GRCm39) missense possibly damaging 0.93
IGL01597:Trpm3 APN 19 22,692,610 (GRCm39) missense probably damaging 1.00
IGL01607:Trpm3 APN 19 22,964,491 (GRCm39) missense probably benign 0.01
IGL01818:Trpm3 APN 19 22,891,838 (GRCm39) missense probably damaging 1.00
IGL01890:Trpm3 APN 19 22,689,083 (GRCm39) missense probably damaging 0.98
IGL02016:Trpm3 APN 19 22,879,433 (GRCm39) nonsense probably null
IGL02324:Trpm3 APN 19 22,676,143 (GRCm39) missense probably benign 0.25
IGL02947:Trpm3 APN 19 22,878,483 (GRCm39) missense probably damaging 0.99
IGL03037:Trpm3 APN 19 22,866,776 (GRCm39) missense possibly damaging 0.85
IGL03128:Trpm3 APN 19 22,891,829 (GRCm39) missense probably damaging 1.00
IGL03335:Trpm3 APN 19 22,903,435 (GRCm39) critical splice donor site probably null
IGL03354:Trpm3 APN 19 22,834,082 (GRCm39) missense probably damaging 1.00
bit UTSW 19 22,965,233 (GRCm39) missense probably benign 0.00
G1patch:Trpm3 UTSW 19 22,903,392 (GRCm39) missense probably damaging 1.00
P0041:Trpm3 UTSW 19 22,875,050 (GRCm39) missense probably benign 0.01
R0001:Trpm3 UTSW 19 22,692,695 (GRCm39) missense possibly damaging 0.70
R0007:Trpm3 UTSW 19 22,964,893 (GRCm39) missense probably benign 0.00
R0007:Trpm3 UTSW 19 22,964,893 (GRCm39) missense probably benign 0.00
R0009:Trpm3 UTSW 19 22,891,810 (GRCm39) missense probably damaging 1.00
R0009:Trpm3 UTSW 19 22,891,810 (GRCm39) missense probably damaging 1.00
R0142:Trpm3 UTSW 19 22,965,280 (GRCm39) missense probably damaging 0.98
R0194:Trpm3 UTSW 19 22,692,720 (GRCm39) splice site probably null
R0268:Trpm3 UTSW 19 22,874,885 (GRCm39) critical splice donor site probably null
R0299:Trpm3 UTSW 19 22,964,237 (GRCm39) missense possibly damaging 0.62
R0449:Trpm3 UTSW 19 22,965,418 (GRCm39) missense probably benign
R0481:Trpm3 UTSW 19 22,878,435 (GRCm39) missense possibly damaging 0.51
R0496:Trpm3 UTSW 19 22,676,142 (GRCm39) missense probably benign 0.00
R0499:Trpm3 UTSW 19 22,964,237 (GRCm39) missense possibly damaging 0.62
R0550:Trpm3 UTSW 19 22,965,176 (GRCm39) missense probably damaging 0.97
R0729:Trpm3 UTSW 19 22,965,153 (GRCm39) missense probably benign
R0883:Trpm3 UTSW 19 22,956,018 (GRCm39) missense probably damaging 1.00
R0926:Trpm3 UTSW 19 22,965,407 (GRCm39) missense probably benign 0.02
R1185:Trpm3 UTSW 19 22,891,781 (GRCm39) splice site probably benign
R1185:Trpm3 UTSW 19 22,891,781 (GRCm39) splice site probably benign
R1513:Trpm3 UTSW 19 22,964,236 (GRCm39) missense possibly damaging 0.96
R1521:Trpm3 UTSW 19 22,878,585 (GRCm39) missense probably damaging 1.00
R1522:Trpm3 UTSW 19 22,955,698 (GRCm39) missense probably benign 0.39
R1569:Trpm3 UTSW 19 22,866,809 (GRCm39) critical splice donor site probably null
R1598:Trpm3 UTSW 19 22,710,388 (GRCm39) missense possibly damaging 0.47
R1600:Trpm3 UTSW 19 22,116,519 (GRCm39) missense probably benign 0.00
R1616:Trpm3 UTSW 19 22,960,076 (GRCm39) missense probably damaging 1.00
R1619:Trpm3 UTSW 19 22,689,271 (GRCm39) missense probably damaging 0.99
R1923:Trpm3 UTSW 19 22,862,776 (GRCm39) missense probably damaging 1.00
R1985:Trpm3 UTSW 19 22,903,446 (GRCm39) missense possibly damaging 0.56
R2249:Trpm3 UTSW 19 22,710,398 (GRCm39) missense probably benign 0.15
R3719:Trpm3 UTSW 19 22,964,354 (GRCm39) missense possibly damaging 0.95
R3766:Trpm3 UTSW 19 22,425,741 (GRCm39) missense probably benign
R3774:Trpm3 UTSW 19 22,965,339 (GRCm39) missense probably benign 0.03
R3774:Trpm3 UTSW 19 22,955,966 (GRCm39) missense possibly damaging 0.66
R3776:Trpm3 UTSW 19 22,955,966 (GRCm39) missense possibly damaging 0.66
R3820:Trpm3 UTSW 19 22,964,813 (GRCm39) missense probably benign 0.00
R3899:Trpm3 UTSW 19 22,878,524 (GRCm39) missense possibly damaging 0.90
R4204:Trpm3 UTSW 19 22,964,928 (GRCm39) missense probably benign 0.00
R4238:Trpm3 UTSW 19 22,956,002 (GRCm39) missense probably damaging 1.00
R4301:Trpm3 UTSW 19 22,964,656 (GRCm39) missense probably benign 0.23
R4344:Trpm3 UTSW 19 22,875,061 (GRCm39) missense probably damaging 0.99
R4345:Trpm3 UTSW 19 22,875,061 (GRCm39) missense probably damaging 0.99
R4365:Trpm3 UTSW 19 22,955,694 (GRCm39) missense probably benign 0.00
R4510:Trpm3 UTSW 19 22,965,381 (GRCm39) missense probably benign 0.00
R4511:Trpm3 UTSW 19 22,965,381 (GRCm39) missense probably benign 0.00
R4565:Trpm3 UTSW 19 22,965,233 (GRCm39) missense probably benign 0.00
R4573:Trpm3 UTSW 19 22,879,506 (GRCm39) missense probably damaging 1.00
R4606:Trpm3 UTSW 19 22,955,988 (GRCm39) missense probably benign 0.26
R4677:Trpm3 UTSW 19 22,964,752 (GRCm39) missense possibly damaging 0.95
R4684:Trpm3 UTSW 19 22,965,145 (GRCm39) missense probably benign
R4713:Trpm3 UTSW 19 22,866,799 (GRCm39) missense possibly damaging 0.83
R4745:Trpm3 UTSW 19 22,692,659 (GRCm39) missense possibly damaging 0.67
R5015:Trpm3 UTSW 19 22,689,076 (GRCm39) missense probably damaging 1.00
R5030:Trpm3 UTSW 19 22,676,130 (GRCm39) missense probably benign 0.01
R5074:Trpm3 UTSW 19 22,862,713 (GRCm39) missense possibly damaging 0.65
R5089:Trpm3 UTSW 19 22,744,120 (GRCm39) missense probably damaging 0.97
R5100:Trpm3 UTSW 19 22,896,130 (GRCm39) missense probably damaging 0.99
R5108:Trpm3 UTSW 19 22,882,078 (GRCm39) missense probably benign 0.06
R5204:Trpm3 UTSW 19 22,425,705 (GRCm39) nonsense probably null
R5213:Trpm3 UTSW 19 22,674,818 (GRCm39) nonsense probably null
R5358:Trpm3 UTSW 19 22,903,332 (GRCm39) missense probably damaging 1.00
R5374:Trpm3 UTSW 19 22,903,548 (GRCm39) nonsense probably null
R5382:Trpm3 UTSW 19 22,862,705 (GRCm39) splice site probably null
R5509:Trpm3 UTSW 19 22,964,622 (GRCm39) missense probably damaging 0.99
R5558:Trpm3 UTSW 19 22,955,937 (GRCm39) missense probably damaging 1.00
R6154:Trpm3 UTSW 19 22,965,178 (GRCm39) missense probably damaging 1.00
R6250:Trpm3 UTSW 19 22,887,418 (GRCm39) missense probably benign 0.01
R6433:Trpm3 UTSW 19 22,878,669 (GRCm39) missense probably damaging 1.00
R6542:Trpm3 UTSW 19 22,903,477 (GRCm39) missense probably benign 0.04
R6630:Trpm3 UTSW 19 22,965,347 (GRCm39) missense probably benign 0.00
R6640:Trpm3 UTSW 19 22,955,946 (GRCm39) missense probably damaging 1.00
R6725:Trpm3 UTSW 19 22,903,392 (GRCm39) missense probably damaging 1.00
R7275:Trpm3 UTSW 19 22,956,048 (GRCm39) missense possibly damaging 0.71
R7371:Trpm3 UTSW 19 22,879,557 (GRCm39) missense probably benign 0.27
R7467:Trpm3 UTSW 19 22,955,698 (GRCm39) missense possibly damaging 0.82
R7488:Trpm3 UTSW 19 22,955,937 (GRCm39) missense probably damaging 1.00
R7495:Trpm3 UTSW 19 22,875,160 (GRCm39) missense probably benign 0.28
R7600:Trpm3 UTSW 19 22,903,458 (GRCm39) missense possibly damaging 0.68
R7710:Trpm3 UTSW 19 22,896,154 (GRCm39) missense probably damaging 0.97
R7877:Trpm3 UTSW 19 22,882,148 (GRCm39) missense probably benign 0.25
R8184:Trpm3 UTSW 19 22,896,060 (GRCm39) missense possibly damaging 0.46
R8234:Trpm3 UTSW 19 22,692,640 (GRCm39) missense possibly damaging 0.47
R8236:Trpm3 UTSW 19 22,964,772 (GRCm39) missense probably benign 0.00
R8443:Trpm3 UTSW 19 22,676,226 (GRCm39) missense possibly damaging 0.90
R8470:Trpm3 UTSW 19 22,887,501 (GRCm39) missense possibly damaging 0.91
R8784:Trpm3 UTSW 19 22,896,040 (GRCm39) missense probably benign 0.07
R8816:Trpm3 UTSW 19 22,965,580 (GRCm39) missense probably damaging 0.97
R8818:Trpm3 UTSW 19 22,955,952 (GRCm39) missense possibly damaging 0.81
R8875:Trpm3 UTSW 19 22,887,493 (GRCm39) missense probably damaging 1.00
R8931:Trpm3 UTSW 19 22,744,034 (GRCm39) missense probably damaging 1.00
R8969:Trpm3 UTSW 19 22,903,308 (GRCm39) missense probably damaging 0.98
R8987:Trpm3 UTSW 19 22,896,124 (GRCm39) missense probably damaging 1.00
R9300:Trpm3 UTSW 19 22,955,745 (GRCm39) missense possibly damaging 0.49
R9327:Trpm3 UTSW 19 22,896,004 (GRCm39) missense possibly damaging 0.56
R9354:Trpm3 UTSW 19 22,425,696 (GRCm39) missense probably benign
R9514:Trpm3 UTSW 19 22,960,040 (GRCm39) missense probably benign 0.42
R9545:Trpm3 UTSW 19 22,878,458 (GRCm39) missense probably benign 0.24
R9712:Trpm3 UTSW 19 22,692,716 (GRCm39) missense possibly damaging 0.55
R9721:Trpm3 UTSW 19 22,866,762 (GRCm39) missense probably benign 0.00
R9750:Trpm3 UTSW 19 22,903,495 (GRCm39) missense probably benign 0.00
Z1176:Trpm3 UTSW 19 22,964,854 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTGGCTCAGGAAGAAGC -3'
(R):5'- TCCATGTTTTCTTGGGCAATAAAGC -3'

Sequencing Primer
(F):5'- CTCAGGAAGAAGCTGGTGATTC -3'
(R):5'- TGGAGATGTGAGAACAATTTAACTG -3'
Posted On 2014-08-25