Mutagenetix > Incidental Mutation

Incidental Mutation 'R2004:Gm597'

223291

Institutional Source

Beutler Lab

Gene Symbol

Gm597

Ensembl Gene

ENSMUSG00000048411

Gene Name

predicted gene 597

Synonyms

LOC210962

MMRRC Submission

040013-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.053) question?

Stock #

R2004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28776117-28780252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28777179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 591 (W591R)

Ref Sequence

ENSEMBL: ENSMUSP00000058140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059937]

AlphaFold

E9Q8J5

Predicted Effect

probably damaging
Transcript: ENSMUST00000059937
AA Change: W591R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000058140
Gene: ENSMUSG00000048411
AA Change: W591R

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	112	129	N/A	INTRINSIC
Pfam:FAM75	137	472	8.1e-14	PFAM
low complexity region	664	675	N/A	INTRINSIC
internal_repeat_1	718	807	1.4e-5	PROSPERO
internal_repeat_1	807	894	1.4e-5	PROSPERO

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 36,895,378	T2I	possibly damaging	Het
Aass	A	T	6: 23,092,562	Y146*	probably null	Het
Adcy2	A	G	13: 68,796,603	L220P	probably damaging	Het
Agl	T	C	3: 116,781,265	Y660C	probably damaging	Het
Ak1	A	G	2: 32,629,610	T17A	probably benign	Het
Amph	G	A	13: 19,142,028	V643M	probably damaging	Het
Ankrd11	A	T	8: 122,902,422		probably null	Het
Ap5b1	T	C	19: 5,570,474	S641P	possibly damaging	Het
Apoc4	A	G	7: 19,681,379	M1T	probably null	Het
Arhgap5	T	C	12: 52,518,034	V596A	probably benign	Het
Ascc3	A	G	10: 50,617,742	E91G	probably damaging	Het
Bach2	T	A	4: 32,580,055	V637E	probably benign	Het
Bicd2	T	G	13: 49,379,405	L489R	possibly damaging	Het
Boc	A	T	16: 44,501,644		probably null	Het
Cbln2	T	A	18: 86,716,666	V188D	probably damaging	Het
Ccl11	A	C	11: 82,062,297	T94P	probably damaging	Het
Cd109	A	T	9: 78,703,762	H1220L	probably benign	Het
Cd226	A	G	18: 89,247,311	I125V	probably benign	Het
Cep135	T	A	5: 76,632,329		probably null	Het
Cgnl1	T	G	9: 71,630,539	E1233A	probably damaging	Het
Ckap5	T	A	2: 91,607,546	D1597E	possibly damaging	Het
Clptm1	A	G	7: 19,646,837	I63T	possibly damaging	Het
Cpsf7	C	T	19: 10,540,709	P428S	probably damaging	Het
Cuedc1	C	T	11: 88,177,390	P155S	probably damaging	Het
Dgkb	T	C	12: 38,084,229	Y45H	probably damaging	Het
Dglucy	T	C	12: 100,856,922	F459L	probably damaging	Het
Dmp1	T	A	5: 104,211,924	D155E	possibly damaging	Het
Dnah1	T	A	14: 31,301,856	I960F	possibly damaging	Het
Drosha	G	T	15: 12,915,381	M795I	probably damaging	Het
Dsg1b	A	G	18: 20,396,475	T326A	probably damaging	Het
Dusp16	T	G	6: 134,718,839	N343T	probably benign	Het
Faim2	T	C	15: 99,500,246	S274G	possibly damaging	Het
Fam155a	A	G	8: 9,770,607	S138P	probably benign	Het
Fam160b1	G	T	19: 57,381,892	V523L	probably benign	Het
Fndc1	T	C	17: 7,804,929	R65G	probably damaging	Het
Fnip2	A	T	3: 79,512,325		probably benign	Het
Grm3	T	C	5: 9,589,793	Y84C	possibly damaging	Het
Herc2	T	C	7: 56,137,859	F1755L	probably damaging	Het
Hivep1	C	T	13: 42,160,149	T1955I	possibly damaging	Het
Ift20	T	C	11: 78,540,971	I97T	probably damaging	Het
Il1f5	T	C	2: 24,281,364	C155R	probably damaging	Het
Lca5l	T	A	16: 96,162,649	K358N	probably damaging	Het
Lca5l	T	C	16: 96,176,018	N196S	possibly damaging	Het
Maf1	G	A	15: 76,353,363	D175N	probably damaging	Het
Mical3	T	C	6: 120,951,322	K996E	probably damaging	Het
Midn	A	G	10: 80,155,149	N331S	probably benign	Het
Mki67	T	A	7: 135,698,509	K1599*	probably null	Het
Mlx	A	G	11: 101,088,979	Q162R	possibly damaging	Het
Ngp	T	C	9: 110,420,861	C76R	probably damaging	Het
Nin	C	T	12: 70,025,477	G1210D	probably benign	Het
Nlgn1	A	G	3: 25,433,870	I738T	probably benign	Het
Nop53	A	C	7: 15,938,228	F465C	probably damaging	Het
Npas3	A	G	12: 54,067,897	D503G	possibly damaging	Het
Npbwr1	T	A	1: 5,916,351	S315C	probably damaging	Het
Nupl2	G	T	5: 24,181,991	G260*	probably null	Het
Ogdh	G	C	11: 6,334,626	R200P	possibly damaging	Het
Olfr1026	T	G	2: 85,923,595		probably null	Het
Olfr142	T	A	2: 90,252,692	I99L	probably benign	Het
Olfr522	C	T	7: 140,162,816	V45I	probably damaging	Het
Olfr659	A	G	7: 104,671,601	T300A	possibly damaging	Het
Olfr828	G	A	9: 18,815,505	S263L	probably benign	Het
Olfr853	A	T	9: 19,537,392	C179*	probably null	Het
Ovgp1	T	A	3: 105,986,993		probably benign	Het
Papln	T	A	12: 83,773,218	C150S	probably damaging	Het
Pde1c	A	T	6: 56,159,011	L316Q	probably damaging	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Piezo2	G	T	18: 63,144,926	D302E	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plin1	A	G	7: 79,725,630		probably benign	Het
Plxnc1	A	G	10: 94,852,622	I698T	probably damaging	Het
Ppp1r12c	G	T	7: 4,482,975	C572*	probably null	Het
Ptgis	T	C	2: 167,214,849	M273V	possibly damaging	Het
Samd14	C	A	11: 95,023,284	T283K	probably damaging	Het
Scnn1g	A	T	7: 121,738,188	K91*	probably null	Het
Slc24a4	A	G	12: 102,213,907	Q95R	probably damaging	Het
Slfn9	T	G	11: 82,988,201	D34A	probably benign	Het
Smarca4	A	T	9: 21,677,480	I1193F	probably damaging	Het
Sphkap	T	C	1: 83,277,911	M706V	probably benign	Het
Stard9	C	A	2: 120,673,636	S221R	probably damaging	Het
Stxbp1	T	C	2: 32,798,189	D488G	probably damaging	Het
Sugp2	C	T	8: 70,242,656		probably null	Het
Tekt5	T	C	16: 10,395,206	I72V	probably benign	Het
Themis	T	A	10: 28,782,724	N582K	probably benign	Het
Tmed11	C	A	5: 108,786,134	M65I	possibly damaging	Het
Top3a	G	T	11: 60,742,489	P927Q	probably damaging	Het
Trpa1	A	T	1: 14,905,983	N165K	possibly damaging	Het
Tsfm	A	G	10: 127,030,794	S2P	probably damaging	Het
Wdr47	C	A	3: 108,627,442	S559*	probably null	Het
Wnt2b	T	C	3: 104,953,015	Y192C	probably damaging	Het
Zfp280b	A	G	10: 76,038,536	D83G	probably benign	Het
Zfp345	T	C	2: 150,472,118	T500A	possibly damaging	Het
Zfp78	T	A	7: 6,379,075	C343S	probably damaging	Het

Other mutations in Gm597

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00740:Gm597	APN	1	28778651	missense	possibly damaging	0.94
IGL00885:Gm597	APN	1	28776845	missense	unknown
IGL01296:Gm597	APN	1	28777056	missense	probably benign	0.23
IGL01476:Gm597	APN	1	28777453	missense	probably benign	0.04
IGL02125:Gm597	APN	1	28776338	missense	possibly damaging	0.91
IGL02410:Gm597	APN	1	28778631	missense	probably benign	0.25
IGL02982:Gm597	APN	1	28778054	missense	probably damaging	1.00
IGL03031:Gm597	APN	1	28778583	missense	probably benign	0.03
IGL03267:Gm597	APN	1	28777121	missense	probably damaging	1.00
R0294:Gm597	UTSW	1	28778663	missense	probably benign	0.00
R0433:Gm597	UTSW	1	28777342	nonsense	probably null
R0485:Gm597	UTSW	1	28778142	missense	probably damaging	1.00
R0645:Gm597	UTSW	1	28776930	missense	probably damaging	0.99
R0744:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R0836:Gm597	UTSW	1	28777821	missense	possibly damaging	0.46
R1036:Gm597	UTSW	1	28777802	missense	probably benign	0.01
R1302:Gm597	UTSW	1	28776340	missense	probably benign	0.00
R1394:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1395:Gm597	UTSW	1	28776809	missense	possibly damaging	0.61
R1514:Gm597	UTSW	1	28778748	missense	possibly damaging	0.83
R1535:Gm597	UTSW	1	28777424	missense	probably damaging	1.00
R2021:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R2022:Gm597	UTSW	1	28778153	missense	probably damaging	0.98
R3115:Gm597	UTSW	1	28776329	missense	possibly damaging	0.92
R3615:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3616:Gm597	UTSW	1	28776575	missense	probably benign	0.26
R3862:Gm597	UTSW	1	28777641	missense	probably damaging	0.98
R4067:Gm597	UTSW	1	28777631	missense	probably damaging	0.98
R4119:Gm597	UTSW	1	28777973	missense	probably damaging	0.99
R4415:Gm597	UTSW	1	28777133	missense	probably benign	0.01
R5010:Gm597	UTSW	1	28777862	missense	possibly damaging	0.52
R5109:Gm597	UTSW	1	28777555	missense	possibly damaging	0.46
R5122:Gm597	UTSW	1	28780060	missense	probably benign	0.00
R5533:Gm597	UTSW	1	28778082	missense	probably damaging	1.00
R6085:Gm597	UTSW	1	28778227	missense	possibly damaging	0.55
R6116:Gm597	UTSW	1	28778699	missense	probably benign	0.01
R6750:Gm597	UTSW	1	28777414	missense	probably damaging	0.98
R6757:Gm597	UTSW	1	28780110	missense	probably damaging	0.98
R6774:Gm597	UTSW	1	28776893	missense	probably benign	0.00
R7156:Gm597	UTSW	1	28776767	missense	possibly damaging	0.53
R7365:Gm597	UTSW	1	28780152	missense	probably benign	0.04
R7739:Gm597	UTSW	1	28777608	missense	possibly damaging	0.72
R7996:Gm597	UTSW	1	28778406	missense	probably damaging	0.98
R8082:Gm597	UTSW	1	28777498	missense	probably benign	0.08
R8281:Gm597	UTSW	1	28778144	missense	possibly damaging	0.77
R8514:Gm597	UTSW	1	28778505	missense	probably damaging	1.00
R8944:Gm597	UTSW	1	28777074	missense	probably benign	0.00
R9042:Gm597	UTSW	1	28776956	missense	possibly damaging	0.72
R9101:Gm597	UTSW	1	28776659	missense	probably benign	0.04
R9106:Gm597	UTSW	1	28776894	missense	probably benign	0.00
R9173:Gm597	UTSW	1	28777349	missense	probably benign	0.22
R9596:Gm597	UTSW	1	28776607	missense	probably benign	0.07
R9632:Gm597	UTSW	1	28778039	missense	probably benign	0.20
R9656:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9659:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9661:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9663:Gm597	UTSW	1	28777455	missense	probably benign	0.02
R9710:Gm597	UTSW	1	28778039	missense	probably benign	0.20

Predicted Primers

PCR Primer
(F):5'- CCTGTCTGTTCAGTAACTGGTAGG -3'
(R):5'- AAGAACCCCTTCACCTGCTG -3'

Sequencing Primer
(F):5'- AGGGGACTTTCTTCTTTCAAAGAG -3'
(R):5'- AAGTCCCATTCAGATCAAGGG -3'

Posted On

2014-08-25