Incidental Mutation 'R2017:Apc'
ID223304
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
MMRRC Submission 040026-MU
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34313602 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1150 (T1150A)
Ref Sequence ENSEMBL: ENSMUSP00000111447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably benign
Transcript: ENSMUST00000079362
AA Change: T1184A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: T1184A

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115781
AA Change: T1150A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: T1150A

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167136
Predicted Effect probably benign
Transcript: ENSMUST00000171187
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Pitpnm1 T C 19: 4,111,873 V955A probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4548:Apc UTSW 18 34281998 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
R7027:Apc UTSW 18 34312076 missense probably damaging 1.00
R7096:Apc UTSW 18 34315957 missense probably damaging 1.00
R7289:Apc UTSW 18 34315271 missense probably damaging 1.00
R7439:Apc UTSW 18 34312073 missense probably damaging 1.00
R7441:Apc UTSW 18 34312073 missense probably damaging 1.00
R7534:Apc UTSW 18 34316962 missense probably damaging 1.00
R7685:Apc UTSW 18 34314208 missense probably damaging 1.00
R7814:Apc UTSW 18 34272539 missense probably damaging 0.98
R7954:Apc UTSW 18 34314268 missense probably damaging 0.99
R8352:Apc UTSW 18 34312751 missense possibly damaging 0.54
R8452:Apc UTSW 18 34312751 missense possibly damaging 0.54
R8497:Apc UTSW 18 34313030 missense possibly damaging 0.81
R8545:Apc UTSW 18 34317031 missense possibly damaging 0.94
R8554:Apc UTSW 18 34312946 missense probably damaging 1.00
RF046:Apc UTSW 18 34282009 critical splice donor site probably benign
RF063:Apc UTSW 18 34282009 critical splice donor site probably benign
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Z1177:Apc UTSW 18 34314463 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACCAGTGGTTCAGAAACAAATCG -3'
(R):5'- GGCCATTTCTTTGTGCTGAAC -3'

Sequencing Primer
(F):5'- AAACCAGTCTCTGTGTCAGG -3'
(R):5'- AACTTGGACGCAGCTGATTC -3'
Posted On2014-08-25