Mutagenetix > Incidental Mutation

Incidental Mutation 'R2017:Atp8b1'

223306

Institutional Source

Beutler Lab

Gene Symbol

Atp8b1

Ensembl Gene

ENSMUSG00000039529

Gene Name

ATPase, class I, type 8B, member 1

Synonyms

FIC1, Ic

MMRRC Submission

040026-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2017 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64528979-64661000 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64540334 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 989 (N989S)

Ref Sequence

ENSEMBL: ENSMUSP00000025482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025482]

AlphaFold

Q148W0

Predicted Effect

probably damaging
Transcript: ENSMUST00000025482
AA Change: N989S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: N989S

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	65	144	5.3e-29	PFAM
Pfam:E1-E2_ATPase	146	413	6e-11	PFAM
Pfam:HAD	451	902	2.4e-21	PFAM
Pfam:Cation_ATPase	532	632	1e-12	PFAM
Pfam:PhoLip_ATPase_C	919	1173	7.3e-82	PFAM
low complexity region	1193	1207	N/A	INTRINSIC
low complexity region	1221	1232	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025C18Rik	T	C	2: 165,079,026	D29G	unknown	Het
Abca13	A	T	11: 9,290,619	L827F	probably damaging	Het
Abcc1	T	A	16: 14,461,204	V1126E	probably damaging	Het
Abcc12	A	G	8: 86,563,988	L41S	probably damaging	Het
Adgrg7	T	C	16: 56,732,806	T643A	probably benign	Het
Angpt2	T	C	8: 18,705,731	N240S	probably damaging	Het
Apc	A	G	18: 34,313,602	T1150A	probably benign	Het
Apob	G	A	12: 8,007,751	D2078N	possibly damaging	Het
Apool	T	A	X: 112,364,561	S234T	probably benign	Het
Ascc3	C	T	10: 50,690,211	P751S	probably benign	Het
Astn2	G	A	4: 65,540,941	T1079I	probably damaging	Het
B3gnt2	T	C	11: 22,836,621	D189G	probably damaging	Het
Bcas1	A	C	2: 170,348,161		probably null	Het
Btk	T	C	X: 134,547,601	D355G	probably benign	Het
C2cd4c	A	G	10: 79,612,989	V108A	possibly damaging	Het
Cbfa2t2	T	C	2: 154,517,807	L264P	probably damaging	Het
Cd22	A	T	7: 30,872,780	L423Q	probably damaging	Het
Cep128	T	C	12: 91,366,464	D9G	probably damaging	Het
Cer1	A	T	4: 82,882,883	V181D	probably damaging	Het
Ciita	T	C	16: 10,511,676	L584P	probably damaging	Het
Cmss1	T	C	16: 57,316,278	D77G	probably damaging	Het
Col4a2	T	C	8: 11,445,086	F1515L	probably benign	Het
Dcaf1	T	A	9: 106,839,088	D360E	probably benign	Het
Dcaf1	A	G	9: 106,847,923	E536G	probably damaging	Het
Dnah2	T	A	11: 69,437,070	I3370F	probably damaging	Het
Dsg1c	T	C	18: 20,266,196	V119A	possibly damaging	Het
Edn3	A	G	2: 174,778,662	E103G	probably benign	Het
Efemp1	G	T	11: 28,921,613	R376L	probably damaging	Het
Eid1	A	G	2: 125,673,201	M4V	probably benign	Het
Emilin3	G	A	2: 160,909,610	R170C	possibly damaging	Het
Epx	T	C	11: 87,874,337	D178G	probably damaging	Het
Fam208b	A	T	13: 3,576,770	I1060K	probably benign	Het
Fam49a	T	A	12: 12,362,361	V208D	probably damaging	Het
Fkbp10	G	A	11: 100,421,673	V252I	possibly damaging	Het
Flnc	G	A	6: 29,443,797		probably null	Het
Fsip2	A	G	2: 82,982,732	K3132E	possibly damaging	Het
Gla	C	T	X: 134,596,322	A39T	probably damaging	Het
H2-Ke6	A	T	17: 34,026,213	M259K	probably damaging	Het
Hivep2	C	T	10: 14,130,757	T1033M	probably damaging	Het
Ikzf4	C	T	10: 128,634,157	G498D	probably damaging	Het
Impg1	T	C	9: 80,440,667	Y95C	probably damaging	Het
Ino80c	T	A	18: 24,111,753	K136*	probably null	Het
Iqsec1	A	C	6: 90,689,930	H508Q	probably benign	Het
Itgb3	A	G	11: 104,637,962	H305R	possibly damaging	Het
Jup	T	A	11: 100,386,341	T14S	probably benign	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 52,725,906	74	probably benign	Het
Klf12	T	C	14: 100,022,637	R219G	possibly damaging	Het
Klhl42	G	T	6: 147,107,793	V377L	probably benign	Het
Large1	A	G	8: 72,852,197	F460S	probably damaging	Het
Loxl3	A	T	6: 83,048,977	D402V	probably damaging	Het
Lrrc37a	T	A	11: 103,501,125	Y1158F	probably benign	Het
Map2	T	A	1: 66,412,799	S365T	probably damaging	Het
Mapk8ip1	A	G	2: 92,391,034		probably null	Het
Med26	A	G	8: 72,496,947	S103P	probably damaging	Het
Muc4	T	C	16: 32,751,303	S394P	possibly damaging	Het
Nle1	G	T	11: 82,905,547	P166Q	probably damaging	Het
Obox5	T	C	7: 15,758,882	I254T	probably benign	Het
Olfr1288	G	T	2: 111,479,187	M134I	probably benign	Het
Olfr371	T	C	8: 85,230,744	L83P	possibly damaging	Het
Olfr406	T	A	11: 74,270,333	W315R	probably benign	Het
Olfr592	T	C	7: 103,186,930	F110L	probably benign	Het
Pacs2	A	T	12: 113,062,457	N545Y	probably damaging	Het
Palld	T	C	8: 61,684,765	E652G	probably damaging	Het
Pgm5	T	C	19: 24,824,312	N184S	probably benign	Het
Pitpnm1	T	C	19: 4,111,873	V955A	probably benign	Het
Plcb1	T	A	2: 135,362,420	I898N	possibly damaging	Het
Pramef12	A	G	4: 144,394,674	V260A	possibly damaging	Het
Prr36	T	A	8: 4,215,205	T182S	probably benign	Het
Prss35	A	G	9: 86,755,512	S112G	probably benign	Het
Ptprj	C	T	2: 90,464,614	V417M	probably damaging	Het
Ptprm	G	T	17: 66,957,153		probably null	Het
Rasgrp2	T	C	19: 6,413,165	V498A	probably benign	Het
Rfx6	A	G	10: 51,721,604	N513S	possibly damaging	Het
Rhbdf1	A	G	11: 32,210,471	I693T	probably damaging	Het
Scn9a	T	C	2: 66,515,321	T1143A	probably damaging	Het
Spata17	A	G	1: 187,048,453	S366P	possibly damaging	Het
Svep1	A	G	4: 58,070,568	L2406P	probably benign	Het
Tgfb2	A	T	1: 186,630,765	Y287*	probably null	Het
Trip11	A	T	12: 101,885,360	V815E	probably benign	Het
Trp53bp2	G	T	1: 182,449,015	V854L	probably benign	Het
Ttc30a1	A	G	2: 75,981,457	L94P	probably benign	Het
Vmn1r78	T	C	7: 12,153,343	S294P	possibly damaging	Het
Vmn2r86	T	C	10: 130,446,713	K678R	probably benign	Het
Yeats2	T	A	16: 20,159,181	N138K	probably benign	Het
Zufsp	A	T	10: 33,927,464	N541K	possibly damaging	Het

Other mutations in Atp8b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Atp8b1	APN	18	64564430	missense	probably benign	0.23
IGL00907:Atp8b1	APN	18	64561705	missense	possibly damaging	0.95
IGL00962:Atp8b1	APN	18	64531444	missense	probably damaging	1.00
IGL01433:Atp8b1	APN	18	64573519	missense	probably benign	0.00
IGL01525:Atp8b1	APN	18	64539252	nonsense	probably null
IGL01645:Atp8b1	APN	18	64546113	missense	probably benign	0.06
IGL02008:Atp8b1	APN	18	64538695	splice site	probably benign
IGL02227:Atp8b1	APN	18	64562190	missense	probably benign
IGL02231:Atp8b1	APN	18	64550384	missense	possibly damaging	0.94
IGL02326:Atp8b1	APN	18	64538583	missense	probably damaging	0.99
IGL02562:Atp8b1	APN	18	64581986	missense	probably benign
IGL02929:Atp8b1	APN	18	64561662	missense	possibly damaging	0.63
enchilada	UTSW	18	64545989	critical splice donor site	probably null
PIT4520001:Atp8b1	UTSW	18	64568180	missense	probably benign	0.34
PIT4696001:Atp8b1	UTSW	18	64539270	missense	possibly damaging	0.93
R0144:Atp8b1	UTSW	18	64571374	splice site	probably benign
R0193:Atp8b1	UTSW	18	64561636	missense	probably benign
R0277:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0308:Atp8b1	UTSW	18	64545244	nonsense	probably null
R0323:Atp8b1	UTSW	18	64568252	missense	possibly damaging	0.94
R0403:Atp8b1	UTSW	18	64540310	missense	probably damaging	1.00
R0601:Atp8b1	UTSW	18	64571653	splice site	probably null
R0614:Atp8b1	UTSW	18	64533587	splice site	probably benign
R0883:Atp8b1	UTSW	18	64564541	missense	probably benign	0.44
R1077:Atp8b1	UTSW	18	64573262	nonsense	probably null
R1292:Atp8b1	UTSW	18	64571021	missense	probably damaging	0.99
R1494:Atp8b1	UTSW	18	64564526	missense	probably damaging	1.00
R1522:Atp8b1	UTSW	18	64550432	missense	probably benign	0.00
R1534:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1535:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1536:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1537:Atp8b1	UTSW	18	64545264	missense	probably damaging	1.00
R1650:Atp8b1	UTSW	18	64571549	splice site	probably benign
R1772:Atp8b1	UTSW	18	64573492	missense	possibly damaging	0.88
R2016:Atp8b1	UTSW	18	64540334	missense	probably damaging	1.00
R2043:Atp8b1	UTSW	18	64605200	missense	possibly damaging	0.94
R2223:Atp8b1	UTSW	18	64564357	missense	possibly damaging	0.88
R3052:Atp8b1	UTSW	18	64553108	missense	probably benign	0.04
R3694:Atp8b1	UTSW	18	64533721	missense	possibly damaging	0.81
R3738:Atp8b1	UTSW	18	64533729	splice site	probably benign
R4211:Atp8b1	UTSW	18	64553047	missense	probably damaging	1.00
R4362:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R4560:Atp8b1	UTSW	18	64556879	nonsense	probably null
R4560:Atp8b1	UTSW	18	64568247	missense	probably benign	0.11
R4562:Atp8b1	UTSW	18	64556891	missense	probably damaging	1.00
R4615:Atp8b1	UTSW	18	64553099	missense	probably null
R4676:Atp8b1	UTSW	18	64538678	missense	probably benign	0.01
R4738:Atp8b1	UTSW	18	64545180	missense	probably benign	0.31
R4774:Atp8b1	UTSW	18	64533659	missense	possibly damaging	0.49
R4808:Atp8b1	UTSW	18	64561711	missense	probably benign	0.01
R4868:Atp8b1	UTSW	18	64551866	missense	probably damaging	1.00
R5162:Atp8b1	UTSW	18	64561662	missense	possibly damaging	0.63
R5289:Atp8b1	UTSW	18	64546087	missense	possibly damaging	0.51
R5328:Atp8b1	UTSW	18	64531391	missense	probably benign	0.00
R5400:Atp8b1	UTSW	18	64545989	critical splice donor site	probably null
R5587:Atp8b1	UTSW	18	64539210	missense	probably damaging	1.00
R5623:Atp8b1	UTSW	18	64546094	missense	possibly damaging	0.85
R5651:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5652:Atp8b1	UTSW	18	64531382	missense	probably benign	0.31
R5653:Atp8b1	UTSW	18	64545197	missense	probably damaging	1.00
R5667:Atp8b1	UTSW	18	64581923	missense	probably damaging	1.00
R5689:Atp8b1	UTSW	18	64564537	missense	probably damaging	1.00
R6008:Atp8b1	UTSW	18	64577616	missense	probably damaging	1.00
R6315:Atp8b1	UTSW	18	64531479	missense	probably damaging	0.97
R6759:Atp8b1	UTSW	18	64546090	missense	probably benign	0.00
R6850:Atp8b1	UTSW	18	64556852	missense	possibly damaging	0.94
R7255:Atp8b1	UTSW	18	64556868	missense	probably damaging	1.00
R7606:Atp8b1	UTSW	18	64555115	missense	probably damaging	1.00
R7635:Atp8b1	UTSW	18	64573305	missense	possibly damaging	0.59
R7639:Atp8b1	UTSW	18	64564543	missense	possibly damaging	0.91
R7698:Atp8b1	UTSW	18	64571022	missense	probably benign	0.03
R7727:Atp8b1	UTSW	18	64545275	missense	probably damaging	1.00
R7779:Atp8b1	UTSW	18	64541382	missense	probably damaging	1.00
R7785:Atp8b1	UTSW	18	64556850	missense	probably damaging	1.00
R7874:Atp8b1	UTSW	18	64571024	missense	probably benign	0.30
R7990:Atp8b1	UTSW	18	64538677	missense	possibly damaging	0.91
R8020:Atp8b1	UTSW	18	64546013	missense	probably damaging	1.00
R8161:Atp8b1	UTSW	18	64556987	missense	probably damaging	1.00
R9007:Atp8b1	UTSW	18	64551860	missense	probably benign	0.40
R9064:Atp8b1	UTSW	18	64564420	missense	probably benign	0.12
R9266:Atp8b1	UTSW	18	64571037	missense	probably benign	0.08
R9266:Atp8b1	UTSW	18	64577457	missense	possibly damaging	0.70
R9326:Atp8b1	UTSW	18	64573273	missense	probably damaging	1.00
X0025:Atp8b1	UTSW	18	64571405	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCTATTGTTGCTTGGCAG -3'
(R):5'- GATTGTTGCTATGGAAAAGCCTG -3'

Sequencing Primer
(F):5'- CAGGTATACCGGGGTTTATCAGAGC -3'
(R):5'- GTGCTACATCTCACTGCATAGAC -3'

Posted On

2014-08-25