Incidental Mutation 'R2017:Pitpnm1'
ID223308
Institutional Source Beutler Lab
Gene Symbol Pitpnm1
Ensembl Gene ENSMUSG00000024851
Gene Namephosphatidylinositol transfer protein, membrane-associated 1
SynonymsDRES9, RdgB
MMRRC Submission 040026-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2017 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4099998-4113965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4111873 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 955 (V955A)
Ref Sequence ENSEMBL: ENSMUSP00000097599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025767] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000117831] [ENSMUST00000121402]
Predicted Effect probably benign
Transcript: ENSMUST00000025767
SMART Domains Protein: ENSMUSP00000025767
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 5.3e-11 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000049658
AA Change: V955A

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: V955A

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100022
AA Change: V955A

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: V955A

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117831
SMART Domains Protein: ENSMUSP00000113807
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1e-10 PFAM
PDB:4APO|B 166 330 1e-113 PDB
SCOP:d1ihga1 170 322 1e-14 SMART
Blast:TPR 231 264 3e-7 BLAST
Blast:TPR 265 298 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121402
SMART Domains Protein: ENSMUSP00000114096
Gene: ENSMUSG00000024847

DomainStartEndE-ValueType
Pfam:FKBP_C 26 155 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151957
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025C18Rik T C 2: 165,079,026 D29G unknown Het
Abca13 A T 11: 9,290,619 L827F probably damaging Het
Abcc1 T A 16: 14,461,204 V1126E probably damaging Het
Abcc12 A G 8: 86,563,988 L41S probably damaging Het
Adgrg7 T C 16: 56,732,806 T643A probably benign Het
Angpt2 T C 8: 18,705,731 N240S probably damaging Het
Apc A G 18: 34,313,602 T1150A probably benign Het
Apob G A 12: 8,007,751 D2078N possibly damaging Het
Apool T A X: 112,364,561 S234T probably benign Het
Ascc3 C T 10: 50,690,211 P751S probably benign Het
Astn2 G A 4: 65,540,941 T1079I probably damaging Het
Atp8b1 T C 18: 64,540,334 N989S probably damaging Het
B3gnt2 T C 11: 22,836,621 D189G probably damaging Het
Bcas1 A C 2: 170,348,161 probably null Het
Btk T C X: 134,547,601 D355G probably benign Het
C2cd4c A G 10: 79,612,989 V108A possibly damaging Het
Cbfa2t2 T C 2: 154,517,807 L264P probably damaging Het
Cd22 A T 7: 30,872,780 L423Q probably damaging Het
Cep128 T C 12: 91,366,464 D9G probably damaging Het
Cer1 A T 4: 82,882,883 V181D probably damaging Het
Ciita T C 16: 10,511,676 L584P probably damaging Het
Cmss1 T C 16: 57,316,278 D77G probably damaging Het
Col4a2 T C 8: 11,445,086 F1515L probably benign Het
Dcaf1 T A 9: 106,839,088 D360E probably benign Het
Dcaf1 A G 9: 106,847,923 E536G probably damaging Het
Dnah2 T A 11: 69,437,070 I3370F probably damaging Het
Dsg1c T C 18: 20,266,196 V119A possibly damaging Het
Edn3 A G 2: 174,778,662 E103G probably benign Het
Efemp1 G T 11: 28,921,613 R376L probably damaging Het
Eid1 A G 2: 125,673,201 M4V probably benign Het
Emilin3 G A 2: 160,909,610 R170C possibly damaging Het
Epx T C 11: 87,874,337 D178G probably damaging Het
Fam208b A T 13: 3,576,770 I1060K probably benign Het
Fam49a T A 12: 12,362,361 V208D probably damaging Het
Fkbp10 G A 11: 100,421,673 V252I possibly damaging Het
Flnc G A 6: 29,443,797 probably null Het
Fsip2 A G 2: 82,982,732 K3132E possibly damaging Het
Gla C T X: 134,596,322 A39T probably damaging Het
H2-Ke6 A T 17: 34,026,213 M259K probably damaging Het
Hivep2 C T 10: 14,130,757 T1033M probably damaging Het
Ikzf4 C T 10: 128,634,157 G498D probably damaging Het
Impg1 T C 9: 80,440,667 Y95C probably damaging Het
Ino80c T A 18: 24,111,753 K136* probably null Het
Iqsec1 A C 6: 90,689,930 H508Q probably benign Het
Itgb3 A G 11: 104,637,962 H305R possibly damaging Het
Jup T A 11: 100,386,341 T14S probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klf12 T C 14: 100,022,637 R219G possibly damaging Het
Klhl42 G T 6: 147,107,793 V377L probably benign Het
Large1 A G 8: 72,852,197 F460S probably damaging Het
Loxl3 A T 6: 83,048,977 D402V probably damaging Het
Lrrc37a T A 11: 103,501,125 Y1158F probably benign Het
Map2 T A 1: 66,412,799 S365T probably damaging Het
Mapk8ip1 A G 2: 92,391,034 probably null Het
Med26 A G 8: 72,496,947 S103P probably damaging Het
Muc4 T C 16: 32,751,303 S394P possibly damaging Het
Nle1 G T 11: 82,905,547 P166Q probably damaging Het
Obox5 T C 7: 15,758,882 I254T probably benign Het
Olfr1288 G T 2: 111,479,187 M134I probably benign Het
Olfr371 T C 8: 85,230,744 L83P possibly damaging Het
Olfr406 T A 11: 74,270,333 W315R probably benign Het
Olfr592 T C 7: 103,186,930 F110L probably benign Het
Pacs2 A T 12: 113,062,457 N545Y probably damaging Het
Palld T C 8: 61,684,765 E652G probably damaging Het
Pgm5 T C 19: 24,824,312 N184S probably benign Het
Plcb1 T A 2: 135,362,420 I898N possibly damaging Het
Pramef12 A G 4: 144,394,674 V260A possibly damaging Het
Prr36 T A 8: 4,215,205 T182S probably benign Het
Prss35 A G 9: 86,755,512 S112G probably benign Het
Ptprj C T 2: 90,464,614 V417M probably damaging Het
Ptprm G T 17: 66,957,153 probably null Het
Rasgrp2 T C 19: 6,413,165 V498A probably benign Het
Rfx6 A G 10: 51,721,604 N513S possibly damaging Het
Rhbdf1 A G 11: 32,210,471 I693T probably damaging Het
Scn9a T C 2: 66,515,321 T1143A probably damaging Het
Spata17 A G 1: 187,048,453 S366P possibly damaging Het
Svep1 A G 4: 58,070,568 L2406P probably benign Het
Tgfb2 A T 1: 186,630,765 Y287* probably null Het
Trip11 A T 12: 101,885,360 V815E probably benign Het
Trp53bp2 G T 1: 182,449,015 V854L probably benign Het
Ttc30a1 A G 2: 75,981,457 L94P probably benign Het
Vmn1r78 T C 7: 12,153,343 S294P possibly damaging Het
Vmn2r86 T C 10: 130,446,713 K678R probably benign Het
Yeats2 T A 16: 20,159,181 N138K probably benign Het
Zufsp A T 10: 33,927,464 N541K possibly damaging Het
Other mutations in Pitpnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Pitpnm1 APN 19 4110665 splice site probably null
IGL00978:Pitpnm1 APN 19 4101228 missense possibly damaging 0.61
IGL02039:Pitpnm1 APN 19 4105032 missense probably benign 0.01
IGL02122:Pitpnm1 APN 19 4107796 missense probably damaging 1.00
IGL02279:Pitpnm1 APN 19 4101207 missense probably damaging 1.00
IGL02316:Pitpnm1 APN 19 4112835 missense probably benign 0.16
IGL02434:Pitpnm1 APN 19 4103377 missense probably benign 0.00
R0926:Pitpnm1 UTSW 19 4112338 missense probably damaging 1.00
R1301:Pitpnm1 UTSW 19 4110831 splice site probably null
R1423:Pitpnm1 UTSW 19 4112392 missense probably damaging 1.00
R1592:Pitpnm1 UTSW 19 4106964 critical splice donor site probably null
R1733:Pitpnm1 UTSW 19 4109960 nonsense probably null
R1844:Pitpnm1 UTSW 19 4112395 missense probably damaging 1.00
R1971:Pitpnm1 UTSW 19 4112450 missense probably damaging 1.00
R1978:Pitpnm1 UTSW 19 4107973 unclassified probably null
R2016:Pitpnm1 UTSW 19 4111873 missense probably benign 0.25
R2019:Pitpnm1 UTSW 19 4113641 missense probably damaging 1.00
R2210:Pitpnm1 UTSW 19 4105253 missense probably damaging 1.00
R2393:Pitpnm1 UTSW 19 4110935 missense probably benign 0.02
R3434:Pitpnm1 UTSW 19 4112234 missense probably damaging 1.00
R3439:Pitpnm1 UTSW 19 4112752 missense probably benign 0.00
R4554:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4555:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4557:Pitpnm1 UTSW 19 4103085 missense probably benign 0.16
R4831:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R4874:Pitpnm1 UTSW 19 4112252 critical splice donor site probably null
R5058:Pitpnm1 UTSW 19 4112758 missense probably benign 0.00
R5069:Pitpnm1 UTSW 19 4111140 missense probably benign 0.44
R5249:Pitpnm1 UTSW 19 4108130 missense probably damaging 1.00
R5288:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5385:Pitpnm1 UTSW 19 4103435 missense probably damaging 0.99
R5619:Pitpnm1 UTSW 19 4103270 missense probably damaging 1.00
R5650:Pitpnm1 UTSW 19 4103319 missense possibly damaging 0.78
R6267:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6341:Pitpnm1 UTSW 19 4102829 nonsense probably null
R6608:Pitpnm1 UTSW 19 4110875 missense probably damaging 1.00
R6739:Pitpnm1 UTSW 19 4110522 missense probably damaging 1.00
R6915:Pitpnm1 UTSW 19 4106947 missense possibly damaging 0.95
R7141:Pitpnm1 UTSW 19 4102787 missense probably damaging 0.97
R7751:Pitpnm1 UTSW 19 4103470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCACGCTCACTGGAGAGAAG -3'
(R):5'- CCCTATGTTCCATGGAAGCATG -3'

Sequencing Primer
(F):5'- CGCTCACTGGAGAGAAGGTCAG -3'
(R):5'- CCATGGAAGCATGGCATGAGTG -3'
Posted On2014-08-25