Incidental Mutation 'R2004:Stard9'
ID223315
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120673636 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 221 (S221R)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000150912] [ENSMUST00000180041]
Predicted Effect probably damaging
Transcript: ENSMUST00000140843
AA Change: S221R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705
AA Change: S221R

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000150912
AA Change: S221R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121874
Gene: ENSMUSG00000033705
AA Change: S221R

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180041
AA Change: S221R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: S221R

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229722
Meta Mutation Damage Score 0.5058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
PIT4151001:Stard9 UTSW 2 120702756 nonsense probably null
PIT4498001:Stard9 UTSW 2 120697435 missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5033:Stard9 UTSW 2 120693399 missense probably benign 0.00
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense probably benign
R7154:Stard9 UTSW 2 120701314 missense probably benign 0.00
R7154:Stard9 UTSW 2 120704542 missense probably benign 0.02
R7165:Stard9 UTSW 2 120704158 missense probably damaging 1.00
R7260:Stard9 UTSW 2 120706938 missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120634274 nonsense probably null
R7282:Stard9 UTSW 2 120698503 missense probably benign 0.00
R7344:Stard9 UTSW 2 120704686 missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120666534 missense probably benign
R7359:Stard9 UTSW 2 120698280 missense probably damaging 1.00
R7375:Stard9 UTSW 2 120665002 splice site probably null
R7410:Stard9 UTSW 2 120701497 missense probably benign 0.41
R7422:Stard9 UTSW 2 120702152 missense probably benign 0.21
R7475:Stard9 UTSW 2 120688110 missense probably damaging 1.00
R7523:Stard9 UTSW 2 120699597 missense probably benign
R7553:Stard9 UTSW 2 120693808 splice site probably null
R7624:Stard9 UTSW 2 120688146 missense probably benign 0.15
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTACAGATGGTTGTGAGCTGCC -3'
(R):5'- TTCTGAACTGTCCTGAGCAG -3'

Sequencing Primer
(F):5'- AGCTGCCATGTGGTTGC -3'
(R):5'- CTGTCCTGAGCAGAAGATAAGC -3'
Posted On2014-08-25