Incidental Mutation 'R2004:Agl'
ID223332
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116781265 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 660 (Y660C)
Ref Sequence ENSEMBL: ENSMUSP00000124149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably damaging
Transcript: ENSMUST00000040603
AA Change: Y660C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: Y660C

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159742
AA Change: Y660C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: Y660C

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159995
AA Change: Y81C
SMART Domains Protein: ENSMUSP00000125246
Gene: ENSMUSG00000033400
AA Change: Y81C

DomainStartEndE-ValueType
Pfam:hGDE_central 119 197 8.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160484
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162792
AA Change: Y660C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: Y660C

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
R7735:Agl UTSW 3 116785146 missense probably benign 0.21
R7770:Agl UTSW 3 116758237 critical splice donor site probably null
X0065:Agl UTSW 3 116781330 nonsense probably null
Z1177:Agl UTSW 3 116781036 missense
Predicted Primers PCR Primer
(F):5'- CATCTGGCTGCAATAATCCCG -3'
(R):5'- CGCATCTGTACAGGGTCTTTTG -3'

Sequencing Primer
(F):5'- GCTGCAATAATCCCGCTATGG -3'
(R):5'- CATCTGTACAGGGTCTTTTGCTTCG -3'
Posted On2014-08-25