Incidental Mutation 'R2004:Dmp1'
ID223344
Institutional Source Beutler Lab
Gene Symbol Dmp1
Ensembl Gene ENSMUSG00000029307
Gene Namedentin matrix protein 1
Synonyms
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location104202613-104214102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104211924 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 155 (D155E)
Ref Sequence ENSEMBL: ENSMUSP00000068053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066708
AA Change: D155E

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068053
Gene: ENSMUSG00000029307
AA Change: D155E

DomainStartEndE-ValueType
Pfam:DMP1 1 503 9.8e-206 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Dmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dmp1 APN 5 104210155 splice site probably benign
IGL01063:Dmp1 APN 5 104207099 start codon destroyed probably null 0.73
IGL01599:Dmp1 APN 5 104212462 nonsense probably null
IGL01631:Dmp1 APN 5 104212868 missense probably benign 0.04
IGL01646:Dmp1 APN 5 104211865 missense probably damaging 1.00
IGL02611:Dmp1 APN 5 104212514 missense probably damaging 1.00
IGL02642:Dmp1 APN 5 104211670 missense probably damaging 0.97
choppers UTSW 5 104207125 missense probably damaging 1.00
R0197:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R0494:Dmp1 UTSW 5 104212208 missense probably damaging 1.00
R0529:Dmp1 UTSW 5 104212226 missense probably benign 0.03
R0850:Dmp1 UTSW 5 104212787 missense possibly damaging 0.86
R0883:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R1858:Dmp1 UTSW 5 104207630 missense possibly damaging 0.92
R1869:Dmp1 UTSW 5 104212076 missense probably damaging 1.00
R1995:Dmp1 UTSW 5 104209913 missense possibly damaging 0.60
R2009:Dmp1 UTSW 5 104212840 missense probably damaging 0.97
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R4716:Dmp1 UTSW 5 104212561 missense probably damaging 0.99
R5687:Dmp1 UTSW 5 104207086 start gained probably benign
R6331:Dmp1 UTSW 5 104207125 missense probably damaging 1.00
R6389:Dmp1 UTSW 5 104212922 missense probably damaging 1.00
R7006:Dmp1 UTSW 5 104212322 missense probably benign 0.02
R7103:Dmp1 UTSW 5 104211863 missense probably damaging 1.00
R7699:Dmp1 UTSW 5 104211724 missense probably damaging 1.00
R8181:Dmp1 UTSW 5 104211514 splice site probably null
R8350:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8379:Dmp1 UTSW 5 104211705 nonsense probably null
R8450:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8531:Dmp1 UTSW 5 104212403 missense probably damaging 1.00
Z1177:Dmp1 UTSW 5 104211652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TACGACAGAGGCCAGTACAGAC -3'
(R):5'- TACCAGCGCTGCTCATTCTG -3'

Sequencing Primer
(F):5'- CTCTCTAAGAGTACGGGGACC -3'
(R):5'- GATCGCTCCTGGTACTCTCGG -3'
Posted On2014-08-25