Incidental Mutation 'R2018:Or4a72'
ID 223355
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 040027-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R2018 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89405737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: V111A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: V111A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099773
AA Change: V111A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: V111A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: V111A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: V111A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,293,899 (GRCm39) F252L possibly damaging Het
4930447A16Rik T G 15: 37,440,742 (GRCm39) probably benign Het
Abca14 A T 7: 119,815,408 (GRCm39) M219L probably benign Het
Abi3bp A G 16: 56,498,159 (GRCm39) T918A probably damaging Het
Acss3 C T 10: 106,772,068 (GRCm39) S669N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adamtsl4 A G 3: 95,588,412 (GRCm39) Y559H probably damaging Het
Adgrg5 T A 8: 95,661,108 (GRCm39) M106K probably damaging Het
Akt1 T C 12: 112,626,059 (GRCm39) N71S probably damaging Het
Amer2 A C 14: 60,615,894 (GRCm39) K30Q probably damaging Het
Anapc5 T C 5: 122,938,587 (GRCm39) K383E probably damaging Het
Ano1 A G 7: 144,207,987 (GRCm39) L258P probably damaging Het
Arb2a A G 13: 78,147,756 (GRCm39) T321A possibly damaging Het
Arhgef10l A G 4: 140,271,695 (GRCm39) S560P probably damaging Het
Arhgef40 T A 14: 52,241,162 (GRCm39) L1395Q probably damaging Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Ces2h T C 8: 105,745,030 (GRCm39) L388P probably damaging Het
Cfap54 T A 10: 92,852,466 (GRCm39) N880I probably benign Het
Cryz T C 3: 154,327,320 (GRCm39) V116A probably damaging Het
Csrp1 G A 1: 135,678,366 (GRCm39) A159T probably damaging Het
Cttnbp2 A G 6: 18,434,517 (GRCm39) F447S probably damaging Het
Cyp4a12a A T 4: 115,184,702 (GRCm39) I328F probably damaging Het
Cyth4 T G 15: 78,492,371 (GRCm39) H133Q probably damaging Het
Ddah2 A G 17: 35,279,402 (GRCm39) I88V possibly damaging Het
Dmbt1 T G 7: 130,712,718 (GRCm39) I1563S possibly damaging Het
Dnajc22 T C 15: 98,999,114 (GRCm39) S100P probably benign Het
Fancl T A 11: 26,372,459 (GRCm39) D123E probably damaging Het
Fbxo30 A G 10: 11,166,772 (GRCm39) Q498R probably damaging Het
Fgd4 T C 16: 16,253,824 (GRCm39) H581R probably benign Het
Gm2663 T C 6: 40,974,900 (GRCm39) Q57R probably benign Het
Gm7247 A T 14: 51,602,804 (GRCm39) M47L possibly damaging Het
Gsdmc2 T A 15: 63,699,975 (GRCm39) probably null Het
Hc A C 2: 34,903,540 (GRCm39) F1038C probably damaging Het
Heatr1 C A 13: 12,429,359 (GRCm39) Q890K possibly damaging Het
Hipk4 C A 7: 27,228,429 (GRCm39) T293K probably damaging Het
Hp1bp3 C A 4: 137,948,943 (GRCm39) A2E probably damaging Het
Il6 T C 5: 30,219,945 (GRCm39) probably null Het
Itga6 A G 2: 71,648,828 (GRCm39) D104G probably benign Het
Krt24 A G 11: 99,173,277 (GRCm39) S293P probably damaging Het
Krt4 C T 15: 101,829,086 (GRCm39) R309Q probably damaging Het
Krt40 A T 11: 99,430,913 (GRCm39) W199R probably damaging Het
Lamc1 T C 1: 153,118,378 (GRCm39) E931G probably benign Het
Lamp3 A T 16: 19,519,961 (GRCm39) M74K probably benign Het
Lgalsl2 A G 7: 5,362,573 (GRCm39) D68G probably benign Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Marchf7 T A 2: 60,059,384 (GRCm39) Y37* probably null Het
Mrpl36 A G 13: 73,479,687 (GRCm39) K66E probably damaging Het
Mrps35 G T 6: 146,962,982 (GRCm39) E229* probably null Het
Mtmr6 T C 14: 60,536,441 (GRCm39) M557T probably benign Het
Myocd A T 11: 65,077,854 (GRCm39) I647N probably damaging Het
Myom2 A C 8: 15,181,151 (GRCm39) L1350F probably damaging Het
Nhsl3 A G 4: 129,116,148 (GRCm39) S884P probably damaging Het
Nosip T A 7: 44,726,033 (GRCm39) S197T probably benign Het
Npat A G 9: 53,473,791 (GRCm39) K528E probably benign Het
Nyap2 A G 1: 81,169,587 (GRCm39) T115A probably benign Het
Obi1 T A 14: 104,759,978 (GRCm39) K24M probably damaging Het
Or10al6 A G 17: 38,083,467 (GRCm39) R317G probably benign Het
Or4c109 G T 2: 88,818,489 (GRCm39) P19Q probably benign Het
Or51b6 T A 7: 103,556,249 (GRCm39) V201D possibly damaging Het
Or5m3 A T 2: 85,838,567 (GRCm39) Y149F probably damaging Het
Or8g55 A G 9: 39,785,354 (GRCm39) Q261R probably benign Het
Orc1 T C 4: 108,447,897 (GRCm39) V48A possibly damaging Het
Pde6d T C 1: 86,474,438 (GRCm39) E69G probably damaging Het
Pdgfrb A T 18: 61,216,406 (GRCm39) D1088V possibly damaging Het
Peg12 A G 7: 62,113,386 (GRCm39) V237A probably benign Het
Phf8-ps T C 17: 33,285,941 (GRCm39) N287S probably benign Het
Piezo1 A G 8: 123,209,451 (GRCm39) F2371L probably benign Het
Podn T A 4: 107,880,570 (GRCm39) S27C probably damaging Het
Pom121l2 A G 13: 22,166,904 (GRCm39) M392V possibly damaging Het
Ppm1b A G 17: 85,301,630 (GRCm39) K170R probably damaging Het
Rab18 A T 18: 6,770,113 (GRCm39) probably null Het
Raet1d G A 10: 22,246,911 (GRCm39) A80T probably damaging Het
Rfx7 T A 9: 72,524,967 (GRCm39) V719E probably benign Het
Ror1 C T 4: 100,265,038 (GRCm39) Q171* probably null Het
Rufy4 G A 1: 74,180,106 (GRCm39) V454M possibly damaging Het
Ryr2 C T 13: 11,866,074 (GRCm39) G292D possibly damaging Het
Ryr3 G T 2: 112,611,410 (GRCm39) N2257K probably benign Het
Saal1 A G 7: 46,348,913 (GRCm39) F306S possibly damaging Het
Sap18 A G 14: 58,036,021 (GRCm39) N69S probably damaging Het
Sar1b A T 11: 51,670,514 (GRCm39) probably null Het
Serpina3n G T 12: 104,375,473 (GRCm39) V182L probably damaging Het
Setd3 A T 12: 108,084,513 (GRCm39) H279Q probably damaging Het
Slc18a2 C A 19: 59,264,937 (GRCm39) A307E possibly damaging Het
Slc4a10 A T 2: 62,064,725 (GRCm39) D193V probably damaging Het
Spire2 T C 8: 124,059,657 (GRCm39) C52R probably damaging Het
Syne2 A T 12: 76,121,353 (GRCm39) I5940F probably damaging Het
Sytl1 C T 4: 132,983,471 (GRCm39) S355N probably damaging Het
Tarbp1 C T 8: 127,154,853 (GRCm39) V1424I probably damaging Het
Tatdn3 A T 1: 190,781,477 (GRCm39) probably null Het
Tbpl1 T A 10: 22,583,576 (GRCm39) E131D probably damaging Het
Telo2 A T 17: 25,324,382 (GRCm39) M501K probably damaging Het
Terb1 A G 8: 105,179,331 (GRCm39) V619A probably benign Het
Tmem132e A G 11: 82,335,989 (GRCm39) T1024A probably benign Het
Tmem30a T C 9: 79,681,500 (GRCm39) D223G probably damaging Het
Tmprss11d A G 5: 86,487,413 (GRCm39) V19A probably damaging Het
Tnks A T 8: 35,318,260 (GRCm39) S872T probably damaging Het
Tnxb A G 17: 34,890,724 (GRCm39) S356G probably benign Het
Tob2 T C 15: 81,735,400 (GRCm39) K190E probably damaging Het
Togaram1 T C 12: 65,049,433 (GRCm39) V1240A possibly damaging Het
Trim13 T A 14: 61,842,335 (GRCm39) C117* probably null Het
Trpv4 G A 5: 114,772,666 (GRCm39) R308C probably damaging Het
Ttn C G 2: 76,585,676 (GRCm39) D21987H probably damaging Het
Ttn C A 2: 76,656,418 (GRCm39) probably null Het
Upp1 A T 11: 9,083,240 (GRCm39) M111L possibly damaging Het
Vmn1r206 A T 13: 22,804,358 (GRCm39) V283E probably damaging Het
Vmn2r79 G T 7: 86,651,634 (GRCm39) L344F probably benign Het
Vmn2r93 T G 17: 18,546,324 (GRCm39) I732S probably damaging Het
Vmn2r96 G T 17: 18,804,263 (GRCm39) M504I probably benign Het
Vps39 T C 2: 120,173,708 (GRCm39) Y147C probably damaging Het
Zbtb20 T A 16: 43,398,015 (GRCm39) C35S possibly damaging Het
Zfp871 A T 17: 32,993,751 (GRCm39) C475S probably damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGTGCATGCAAGTACC -3'
(R):5'- GTGACAGTCATTACCAGCCC -3'

Sequencing Primer
(F):5'- GTCTGTGCATGCAAGTACCAATAATG -3'
(R):5'- AGTCATTACCAGCCCCTCCTTG -3'
Posted On 2014-08-25