Incidental Mutation 'R2004:Olfr853'
ID223404
Institutional Source Beutler Lab
Gene Symbol Olfr853
Ensembl Gene ENSMUSG00000051160
Gene Nameolfactory receptor 853
SynonymsMOR154-1, GA_x6K02T2PVTD-13277703-13276786
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19534202-19541076 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19537392 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 179 (C179*)
Ref Sequence ENSEMBL: ENSMUSP00000150773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058296] [ENSMUST00000213834]
Predicted Effect probably null
Transcript: ENSMUST00000058296
AA Change: C179*
SMART Domains Protein: ENSMUSP00000053262
Gene: ENSMUSG00000051160
AA Change: C179*

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 206 1.7e-7 PFAM
Pfam:7tm_1 41 290 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212273
Predicted Effect probably null
Transcript: ENSMUST00000213834
AA Change: C179*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Olfr853
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Olfr853 APN 9 19537852 missense possibly damaging 0.94
IGL02078:Olfr853 APN 9 19537453 missense probably benign 0.14
IGL02092:Olfr853 APN 9 19537750 missense probably damaging 0.99
IGL02728:Olfr853 APN 9 19537846 missense possibly damaging 0.95
R0245:Olfr853 UTSW 9 19537112 missense probably benign 0.01
R1331:Olfr853 UTSW 9 19537546 missense probably benign 0.03
R1661:Olfr853 UTSW 9 19537328 missense probably benign 0.00
R1696:Olfr853 UTSW 9 19537894 missense probably damaging 1.00
R2182:Olfr853 UTSW 9 19537342 missense probably benign 0.24
R3730:Olfr853 UTSW 9 19537151 missense probably benign 0.01
R4002:Olfr853 UTSW 9 19537906 missense probably benign 0.00
R4627:Olfr853 UTSW 9 19537673 missense possibly damaging 0.86
R5027:Olfr853 UTSW 9 19537277 missense probably damaging 1.00
R5486:Olfr853 UTSW 9 19537294 missense probably benign
R5931:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R6229:Olfr853 UTSW 9 19537718 missense possibly damaging 0.91
R6564:Olfr853 UTSW 9 19537210 missense possibly damaging 0.95
R6718:Olfr853 UTSW 9 19537199 missense probably damaging 1.00
R7247:Olfr853 UTSW 9 19537333 missense probably benign 0.38
R7347:Olfr853 UTSW 9 19537099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGCTGTCCCATAGAACAAGG -3'
(R):5'- TATGTGGCCATCTGCAATCCC -3'

Sequencing Primer
(F):5'- CACTGACAGATGAGATCCACATGTTG -3'
(R):5'- CCTTCGCTACACAGACATCATG -3'
Posted On2014-08-25