Incidental Mutation 'R2018:Dmbt1'
ID223424
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 040027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R2018 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 131110989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1563 (I1563S)
Ref Sequence ENSEMBL: ENSMUSP00000081556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084509
AA Change: I1563S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: I1563S

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208311
AA Change: I1574S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000213064
AA Change: I1400S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.2545 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
4921501E09Rik T C 17: 33,066,967 N287S probably benign Het
4930447A16Rik T G 15: 37,440,498 probably benign Het
Abca14 A T 7: 120,216,185 M219L probably benign Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamtsl4 A G 3: 95,681,102 Y559H probably damaging Het
Adgrg5 T A 8: 94,934,480 M106K probably damaging Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amer2 A C 14: 60,378,445 K30Q probably damaging Het
Anapc5 T C 5: 122,800,524 K383E probably damaging Het
Ano1 A G 7: 144,654,250 L258P probably damaging Het
Arhgef10l A G 4: 140,544,384 S560P probably damaging Het
Arhgef40 T A 14: 52,003,705 L1395Q probably damaging Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
C77080 A G 4: 129,222,355 S884P probably damaging Het
Ces2h T C 8: 105,018,398 L388P probably damaging Het
Cfap54 T A 10: 93,016,604 N880I probably benign Het
Cryz T C 3: 154,621,683 V116A probably damaging Het
Csrp1 G A 1: 135,750,628 A159T probably damaging Het
Cttnbp2 A G 6: 18,434,518 F447S probably damaging Het
Cyp4a12a A T 4: 115,327,505 I328F probably damaging Het
Cyth4 T G 15: 78,608,171 H133Q probably damaging Het
Ddah2 A G 17: 35,060,426 I88V possibly damaging Het
Dnajc22 T C 15: 99,101,233 S100P probably benign Het
Fam172a A G 13: 77,999,637 T321A possibly damaging Het
Fancl T A 11: 26,422,459 D123E probably damaging Het
Fbxo30 A G 10: 11,291,028 Q498R probably damaging Het
Fgd4 T C 16: 16,435,960 H581R probably benign Het
Gm2663 T C 6: 40,997,966 Q57R probably benign Het
Gm5065 A G 7: 5,359,574 D68G probably benign Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gsdmc2 T A 15: 63,828,126 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Heatr1 C A 13: 12,414,478 Q890K possibly damaging Het
Hipk4 C A 7: 27,529,004 T293K probably damaging Het
Hp1bp3 C A 4: 138,221,632 A2E probably damaging Het
Il6 T C 5: 30,014,947 probably null Het
Itga6 A G 2: 71,818,484 D104G probably benign Het
Krt24 A G 11: 99,282,451 S293P probably damaging Het
Krt4 C T 15: 101,920,651 R309Q probably damaging Het
Krt40 A T 11: 99,540,087 W199R probably damaging Het
Lamc1 T C 1: 153,242,632 E931G probably benign Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Magel2 G A 7: 62,379,096 V583I unknown Het
March7 T A 2: 60,229,040 Y37* probably null Het
Mrpl36 A G 13: 73,331,568 K66E probably damaging Het
Mrps35 G T 6: 147,061,484 E229* probably null Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myocd A T 11: 65,187,028 I647N probably damaging Het
Myom2 A C 8: 15,131,151 L1350F probably damaging Het
Nosip T A 7: 45,076,609 S197T probably benign Het
Npat A G 9: 53,562,491 K528E probably benign Het
Nyap2 A G 1: 81,191,872 T115A probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1214 G T 2: 88,988,145 P19Q probably benign Het
Olfr122 A G 17: 37,772,576 R317G probably benign Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr65 T A 7: 103,907,042 V201D possibly damaging Het
Olfr972 A G 9: 39,874,058 Q261R probably benign Het
Orc1 T C 4: 108,590,700 V48A possibly damaging Het
Pde6d T C 1: 86,546,716 E69G probably damaging Het
Pdgfrb A T 18: 61,083,334 D1088V possibly damaging Het
Peg12 A G 7: 62,463,638 V237A probably benign Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Podn T A 4: 108,023,373 S27C probably damaging Het
Pom121l2 A G 13: 21,982,734 M392V possibly damaging Het
Ppm1b A G 17: 84,994,202 K170R probably damaging Het
Rab18 A T 18: 6,770,113 probably null Het
Raet1d G A 10: 22,371,012 A80T probably damaging Het
Rfx7 T A 9: 72,617,685 V719E probably benign Het
Rnf219 T A 14: 104,522,542 K24M probably damaging Het
Ror1 C T 4: 100,407,841 Q171* probably null Het
Rufy4 G A 1: 74,140,947 V454M possibly damaging Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Saal1 A G 7: 46,699,489 F306S possibly damaging Het
Sap18 A G 14: 57,798,564 N69S probably damaging Het
Sar1b A T 11: 51,779,687 probably null Het
Serpina3n G T 12: 104,409,214 V182L probably damaging Het
Setd3 A T 12: 108,118,254 H279Q probably damaging Het
Slc18a2 C A 19: 59,276,505 A307E possibly damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Syne2 A T 12: 76,074,579 I5940F probably damaging Het
Sytl1 C T 4: 133,256,160 S355N probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tatdn3 A T 1: 191,049,280 probably null Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Telo2 A T 17: 25,105,408 M501K probably damaging Het
Terb1 A G 8: 104,452,699 V619A probably benign Het
Tmem132e A G 11: 82,445,163 T1024A probably benign Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Tmprss11d A G 5: 86,339,554 V19A probably damaging Het
Tnks A T 8: 34,851,106 S872T probably damaging Het
Tnxb A G 17: 34,671,750 S356G probably benign Het
Tob2 T C 15: 81,851,199 K190E probably damaging Het
Togaram1 T C 12: 65,002,659 V1240A possibly damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Trpv4 G A 5: 114,634,605 R308C probably damaging Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Ttn C A 2: 76,826,074 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn1r206 A T 13: 22,620,188 V283E probably damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vmn2r93 T G 17: 18,326,062 I732S probably damaging Het
Vmn2r96 G T 17: 18,584,001 M504I probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Zbtb20 T A 16: 43,577,652 C35S possibly damaging Het
Zfp871 A T 17: 32,774,777 C475S probably damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7584:Dmbt1 UTSW 7 131088751 nonsense probably null
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGCAAGATGAATTCCCCTGG -3'
(R):5'- TGTCCCCAAGAAAATACAGGAG -3'

Sequencing Primer
(F):5'- GCAAGATGAATTCCCCTGGGTTTAAG -3'
(R):5'- GTGGCACCTGCAGTCCTAATAAG -3'
Posted On2014-08-25