Incidental Mutation 'R2004:Plxnc1'
ID223425
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94852622 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 698 (I698T)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
Predicted Effect probably damaging
Transcript: ENSMUST00000099337
AA Change: I698T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: I698T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181244
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 unclassified probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 intron probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R7965:Plxnc1 UTSW 10 94843836 missense probably benign
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAGTCTCCCACCTGAATGTC -3'
(R):5'- GACACGAATCTTCAGCCCTC -3'

Sequencing Primer
(F):5'- GAGTCTCCCACCTGAATGTCAAATG -3'
(R):5'- TAGTGAGTTCTTCGAACCGCAAC -3'
Posted On2014-08-25