Incidental Mutation 'R2004:Ogdh'
ID223428
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
MMRRC Submission 040013-MU
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 6334626 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 200 (R200P)
Ref Sequence ENSEMBL: ENSMUSP00000080569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
Predicted Effect probably benign
Transcript: ENSMUST00000003461
AA Change: R204P

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456
AA Change: R204P

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000081894
AA Change: R200P

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456
AA Change: R200P

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093350
AA Change: R215P

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: R215P

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101554
AA Change: R204P

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456
AA Change: R204P

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0328:Ogdh UTSW 11 6347216 missense probably benign 0.01
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6350655 nonsense probably null
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R4796:Ogdh UTSW 11 6340570 missense probably benign 0.01
R5333:Ogdh UTSW 11 6352126 missense probably damaging 1.00
R5592:Ogdh UTSW 11 6316763 splice site probably null
R6318:Ogdh UTSW 11 6349390 missense probably damaging 0.99
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6349329 missense probably benign 0.38
R8348:Ogdh UTSW 11 6342619 missense probably damaging 0.98
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGCTTGTTTTCATATACATCAGGGG -3'
(R):5'- TCAGTTTCTTAAAACCACAGGACC -3'

Sequencing Primer
(F):5'- ACATCAGGGGTATGTGATATTTTTC -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2014-08-25