Incidental Mutation 'R2018:Cfap54'
ID223468
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission 040027-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2018 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93016604 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 880 (N880I)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]
Predicted Effect probably benign
Transcript: ENSMUST00000168110
AA Change: N880I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: N880I

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170065
AA Change: E164D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000212902
AA Change: N880I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
4921501E09Rik T C 17: 33,066,967 N287S probably benign Het
4930447A16Rik T G 15: 37,440,498 probably benign Het
Abca14 A T 7: 120,216,185 M219L probably benign Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamtsl4 A G 3: 95,681,102 Y559H probably damaging Het
Adgrg5 T A 8: 94,934,480 M106K probably damaging Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amer2 A C 14: 60,378,445 K30Q probably damaging Het
Anapc5 T C 5: 122,800,524 K383E probably damaging Het
Ano1 A G 7: 144,654,250 L258P probably damaging Het
Arhgef10l A G 4: 140,544,384 S560P probably damaging Het
Arhgef40 T A 14: 52,003,705 L1395Q probably damaging Het
Arid1a A T 4: 133,681,834 D1787E unknown Het
C77080 A G 4: 129,222,355 S884P probably damaging Het
Ces2h T C 8: 105,018,398 L388P probably damaging Het
Cryz T C 3: 154,621,683 V116A probably damaging Het
Csrp1 G A 1: 135,750,628 A159T probably damaging Het
Cttnbp2 A G 6: 18,434,518 F447S probably damaging Het
Cyp4a12a A T 4: 115,327,505 I328F probably damaging Het
Cyth4 T G 15: 78,608,171 H133Q probably damaging Het
Ddah2 A G 17: 35,060,426 I88V possibly damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnajc22 T C 15: 99,101,233 S100P probably benign Het
Fam172a A G 13: 77,999,637 T321A possibly damaging Het
Fancl T A 11: 26,422,459 D123E probably damaging Het
Fbxo30 A G 10: 11,291,028 Q498R probably damaging Het
Fgd4 T C 16: 16,435,960 H581R probably benign Het
Gm2663 T C 6: 40,997,966 Q57R probably benign Het
Gm5065 A G 7: 5,359,574 D68G probably benign Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gsdmc2 T A 15: 63,828,126 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Heatr1 C A 13: 12,414,478 Q890K possibly damaging Het
Hipk4 C A 7: 27,529,004 T293K probably damaging Het
Hp1bp3 C A 4: 138,221,632 A2E probably damaging Het
Il6 T C 5: 30,014,947 probably null Het
Itga6 A G 2: 71,818,484 D104G probably benign Het
Krt24 A G 11: 99,282,451 S293P probably damaging Het
Krt4 C T 15: 101,920,651 R309Q probably damaging Het
Krt40 A T 11: 99,540,087 W199R probably damaging Het
Lamc1 T C 1: 153,242,632 E931G probably benign Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Magel2 G A 7: 62,379,096 V583I unknown Het
March7 T A 2: 60,229,040 Y37* probably null Het
Mrpl36 A G 13: 73,331,568 K66E probably damaging Het
Mrps35 G T 6: 147,061,484 E229* probably null Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myocd A T 11: 65,187,028 I647N probably damaging Het
Myom2 A C 8: 15,131,151 L1350F probably damaging Het
Nosip T A 7: 45,076,609 S197T probably benign Het
Npat A G 9: 53,562,491 K528E probably benign Het
Nyap2 A G 1: 81,191,872 T115A probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1214 G T 2: 88,988,145 P19Q probably benign Het
Olfr122 A G 17: 37,772,576 R317G probably benign Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr65 T A 7: 103,907,042 V201D possibly damaging Het
Olfr972 A G 9: 39,874,058 Q261R probably benign Het
Orc1 T C 4: 108,590,700 V48A possibly damaging Het
Pde6d T C 1: 86,546,716 E69G probably damaging Het
Pdgfrb A T 18: 61,083,334 D1088V possibly damaging Het
Peg12 A G 7: 62,463,638 V237A probably benign Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Podn T A 4: 108,023,373 S27C probably damaging Het
Pom121l2 A G 13: 21,982,734 M392V possibly damaging Het
Ppm1b A G 17: 84,994,202 K170R probably damaging Het
Rab18 A T 18: 6,770,113 probably null Het
Raet1d G A 10: 22,371,012 A80T probably damaging Het
Rfx7 T A 9: 72,617,685 V719E probably benign Het
Rnf219 T A 14: 104,522,542 K24M probably damaging Het
Ror1 C T 4: 100,407,841 Q171* probably null Het
Rufy4 G A 1: 74,140,947 V454M possibly damaging Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Saal1 A G 7: 46,699,489 F306S possibly damaging Het
Sap18 A G 14: 57,798,564 N69S probably damaging Het
Sar1b A T 11: 51,779,687 probably null Het
Serpina3n G T 12: 104,409,214 V182L probably damaging Het
Setd3 A T 12: 108,118,254 H279Q probably damaging Het
Slc18a2 C A 19: 59,276,505 A307E possibly damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Syne2 A T 12: 76,074,579 I5940F probably damaging Het
Sytl1 C T 4: 133,256,160 S355N probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tatdn3 A T 1: 191,049,280 probably null Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Telo2 A T 17: 25,105,408 M501K probably damaging Het
Terb1 A G 8: 104,452,699 V619A probably benign Het
Tmem132e A G 11: 82,445,163 T1024A probably benign Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Tmprss11d A G 5: 86,339,554 V19A probably damaging Het
Tnks A T 8: 34,851,106 S872T probably damaging Het
Tnxb A G 17: 34,671,750 S356G probably benign Het
Tob2 T C 15: 81,851,199 K190E probably damaging Het
Togaram1 T C 12: 65,002,659 V1240A possibly damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Trpv4 G A 5: 114,634,605 R308C probably damaging Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Ttn C A 2: 76,826,074 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn1r206 A T 13: 22,620,188 V283E probably damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vmn2r93 T G 17: 18,326,062 I732S probably damaging Het
Vmn2r96 G T 17: 18,584,001 M504I probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Zbtb20 T A 16: 43,577,652 C35S possibly damaging Het
Zfp871 A T 17: 32,774,777 C475S probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 intron probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTAACCTCTGAGATGAACGGCG -3'
(R):5'- TTAGACATACGCGTCTGTTTCC -3'

Sequencing Primer
(F):5'- GCGGGCTTCAGGGTCAC -3'
(R):5'- GCGTCTGTTTCCATCGAAGACG -3'
Posted On2014-08-25