Incidental Mutation 'R2018:Cfap54'
ID 223468
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Name cilia and flagella associated protein 54
Synonyms LOC380653, Gm872, 4930485B16Rik
MMRRC Submission 040027-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2018 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 92611481-92917480 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 92852466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 880 (N880I)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000168110
AA Change: N880I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: N880I

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170065
AA Change: E164D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000212902
AA Change: N880I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 111 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,293,899 (GRCm39) F252L possibly damaging Het
4930447A16Rik T G 15: 37,440,742 (GRCm39) probably benign Het
Abca14 A T 7: 119,815,408 (GRCm39) M219L probably benign Het
Abi3bp A G 16: 56,498,159 (GRCm39) T918A probably damaging Het
Acss3 C T 10: 106,772,068 (GRCm39) S669N probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adamtsl4 A G 3: 95,588,412 (GRCm39) Y559H probably damaging Het
Adgrg5 T A 8: 95,661,108 (GRCm39) M106K probably damaging Het
Akt1 T C 12: 112,626,059 (GRCm39) N71S probably damaging Het
Amer2 A C 14: 60,615,894 (GRCm39) K30Q probably damaging Het
Anapc5 T C 5: 122,938,587 (GRCm39) K383E probably damaging Het
Ano1 A G 7: 144,207,987 (GRCm39) L258P probably damaging Het
Arb2a A G 13: 78,147,756 (GRCm39) T321A possibly damaging Het
Arhgef10l A G 4: 140,271,695 (GRCm39) S560P probably damaging Het
Arhgef40 T A 14: 52,241,162 (GRCm39) L1395Q probably damaging Het
Arid1a A T 4: 133,409,145 (GRCm39) D1787E unknown Het
Ces2h T C 8: 105,745,030 (GRCm39) L388P probably damaging Het
Cryz T C 3: 154,327,320 (GRCm39) V116A probably damaging Het
Csrp1 G A 1: 135,678,366 (GRCm39) A159T probably damaging Het
Cttnbp2 A G 6: 18,434,517 (GRCm39) F447S probably damaging Het
Cyp4a12a A T 4: 115,184,702 (GRCm39) I328F probably damaging Het
Cyth4 T G 15: 78,492,371 (GRCm39) H133Q probably damaging Het
Ddah2 A G 17: 35,279,402 (GRCm39) I88V possibly damaging Het
Dmbt1 T G 7: 130,712,718 (GRCm39) I1563S possibly damaging Het
Dnajc22 T C 15: 98,999,114 (GRCm39) S100P probably benign Het
Fancl T A 11: 26,372,459 (GRCm39) D123E probably damaging Het
Fbxo30 A G 10: 11,166,772 (GRCm39) Q498R probably damaging Het
Fgd4 T C 16: 16,253,824 (GRCm39) H581R probably benign Het
Gm2663 T C 6: 40,974,900 (GRCm39) Q57R probably benign Het
Gm7247 A T 14: 51,602,804 (GRCm39) M47L possibly damaging Het
Gsdmc2 T A 15: 63,699,975 (GRCm39) probably null Het
Hc A C 2: 34,903,540 (GRCm39) F1038C probably damaging Het
Heatr1 C A 13: 12,429,359 (GRCm39) Q890K possibly damaging Het
Hipk4 C A 7: 27,228,429 (GRCm39) T293K probably damaging Het
Hp1bp3 C A 4: 137,948,943 (GRCm39) A2E probably damaging Het
Il6 T C 5: 30,219,945 (GRCm39) probably null Het
Itga6 A G 2: 71,648,828 (GRCm39) D104G probably benign Het
Krt24 A G 11: 99,173,277 (GRCm39) S293P probably damaging Het
Krt4 C T 15: 101,829,086 (GRCm39) R309Q probably damaging Het
Krt40 A T 11: 99,430,913 (GRCm39) W199R probably damaging Het
Lamc1 T C 1: 153,118,378 (GRCm39) E931G probably benign Het
Lamp3 A T 16: 19,519,961 (GRCm39) M74K probably benign Het
Lgalsl2 A G 7: 5,362,573 (GRCm39) D68G probably benign Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Marchf7 T A 2: 60,059,384 (GRCm39) Y37* probably null Het
Mrpl36 A G 13: 73,479,687 (GRCm39) K66E probably damaging Het
Mrps35 G T 6: 146,962,982 (GRCm39) E229* probably null Het
Mtmr6 T C 14: 60,536,441 (GRCm39) M557T probably benign Het
Myocd A T 11: 65,077,854 (GRCm39) I647N probably damaging Het
Myom2 A C 8: 15,181,151 (GRCm39) L1350F probably damaging Het
Nhsl3 A G 4: 129,116,148 (GRCm39) S884P probably damaging Het
Nosip T A 7: 44,726,033 (GRCm39) S197T probably benign Het
Npat A G 9: 53,473,791 (GRCm39) K528E probably benign Het
Nyap2 A G 1: 81,169,587 (GRCm39) T115A probably benign Het
Obi1 T A 14: 104,759,978 (GRCm39) K24M probably damaging Het
Or10al6 A G 17: 38,083,467 (GRCm39) R317G probably benign Het
Or4a72 A G 2: 89,405,737 (GRCm39) V111A probably damaging Het
Or4c109 G T 2: 88,818,489 (GRCm39) P19Q probably benign Het
Or51b6 T A 7: 103,556,249 (GRCm39) V201D possibly damaging Het
Or5m3 A T 2: 85,838,567 (GRCm39) Y149F probably damaging Het
Or8g55 A G 9: 39,785,354 (GRCm39) Q261R probably benign Het
Orc1 T C 4: 108,447,897 (GRCm39) V48A possibly damaging Het
Pde6d T C 1: 86,474,438 (GRCm39) E69G probably damaging Het
Pdgfrb A T 18: 61,216,406 (GRCm39) D1088V possibly damaging Het
Peg12 A G 7: 62,113,386 (GRCm39) V237A probably benign Het
Phf8-ps T C 17: 33,285,941 (GRCm39) N287S probably benign Het
Piezo1 A G 8: 123,209,451 (GRCm39) F2371L probably benign Het
Podn T A 4: 107,880,570 (GRCm39) S27C probably damaging Het
Pom121l2 A G 13: 22,166,904 (GRCm39) M392V possibly damaging Het
Ppm1b A G 17: 85,301,630 (GRCm39) K170R probably damaging Het
Rab18 A T 18: 6,770,113 (GRCm39) probably null Het
Raet1d G A 10: 22,246,911 (GRCm39) A80T probably damaging Het
Rfx7 T A 9: 72,524,967 (GRCm39) V719E probably benign Het
Ror1 C T 4: 100,265,038 (GRCm39) Q171* probably null Het
Rufy4 G A 1: 74,180,106 (GRCm39) V454M possibly damaging Het
Ryr2 C T 13: 11,866,074 (GRCm39) G292D possibly damaging Het
Ryr3 G T 2: 112,611,410 (GRCm39) N2257K probably benign Het
Saal1 A G 7: 46,348,913 (GRCm39) F306S possibly damaging Het
Sap18 A G 14: 58,036,021 (GRCm39) N69S probably damaging Het
Sar1b A T 11: 51,670,514 (GRCm39) probably null Het
Serpina3n G T 12: 104,375,473 (GRCm39) V182L probably damaging Het
Setd3 A T 12: 108,084,513 (GRCm39) H279Q probably damaging Het
Slc18a2 C A 19: 59,264,937 (GRCm39) A307E possibly damaging Het
Slc4a10 A T 2: 62,064,725 (GRCm39) D193V probably damaging Het
Spire2 T C 8: 124,059,657 (GRCm39) C52R probably damaging Het
Syne2 A T 12: 76,121,353 (GRCm39) I5940F probably damaging Het
Sytl1 C T 4: 132,983,471 (GRCm39) S355N probably damaging Het
Tarbp1 C T 8: 127,154,853 (GRCm39) V1424I probably damaging Het
Tatdn3 A T 1: 190,781,477 (GRCm39) probably null Het
Tbpl1 T A 10: 22,583,576 (GRCm39) E131D probably damaging Het
Telo2 A T 17: 25,324,382 (GRCm39) M501K probably damaging Het
Terb1 A G 8: 105,179,331 (GRCm39) V619A probably benign Het
Tmem132e A G 11: 82,335,989 (GRCm39) T1024A probably benign Het
Tmem30a T C 9: 79,681,500 (GRCm39) D223G probably damaging Het
Tmprss11d A G 5: 86,487,413 (GRCm39) V19A probably damaging Het
Tnks A T 8: 35,318,260 (GRCm39) S872T probably damaging Het
Tnxb A G 17: 34,890,724 (GRCm39) S356G probably benign Het
Tob2 T C 15: 81,735,400 (GRCm39) K190E probably damaging Het
Togaram1 T C 12: 65,049,433 (GRCm39) V1240A possibly damaging Het
Trim13 T A 14: 61,842,335 (GRCm39) C117* probably null Het
Trpv4 G A 5: 114,772,666 (GRCm39) R308C probably damaging Het
Ttn C G 2: 76,585,676 (GRCm39) D21987H probably damaging Het
Ttn C A 2: 76,656,418 (GRCm39) probably null Het
Upp1 A T 11: 9,083,240 (GRCm39) M111L possibly damaging Het
Vmn1r206 A T 13: 22,804,358 (GRCm39) V283E probably damaging Het
Vmn2r79 G T 7: 86,651,634 (GRCm39) L344F probably benign Het
Vmn2r93 T G 17: 18,546,324 (GRCm39) I732S probably damaging Het
Vmn2r96 G T 17: 18,804,263 (GRCm39) M504I probably benign Het
Vps39 T C 2: 120,173,708 (GRCm39) Y147C probably damaging Het
Zbtb20 T A 16: 43,398,015 (GRCm39) C35S possibly damaging Het
Zfp871 A T 17: 32,993,751 (GRCm39) C475S probably damaging Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 92,917,385 (GRCm39) missense unknown
IGL02034:Cfap54 APN 10 92,897,347 (GRCm39) missense probably damaging 0.99
IGL02082:Cfap54 APN 10 92,917,320 (GRCm39) missense unknown
IGL02434:Cfap54 APN 10 92,902,616 (GRCm39) missense probably benign 0.20
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0011:Cfap54 UTSW 10 92,901,087 (GRCm39) missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0032:Cfap54 UTSW 10 92,768,559 (GRCm39) missense probably benign 0.04
R0040:Cfap54 UTSW 10 92,812,901 (GRCm39) missense probably benign 0.33
R0044:Cfap54 UTSW 10 92,871,295 (GRCm39) missense probably null 0.46
R0086:Cfap54 UTSW 10 92,864,456 (GRCm39) missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 92,864,514 (GRCm39) missense probably damaging 1.00
R0194:Cfap54 UTSW 10 92,870,524 (GRCm39) unclassified probably benign
R0234:Cfap54 UTSW 10 92,735,022 (GRCm39) nonsense probably null
R0308:Cfap54 UTSW 10 92,721,226 (GRCm39) missense unknown
R0332:Cfap54 UTSW 10 92,871,319 (GRCm39) missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92,612,075 (GRCm39) missense probably benign 0.00
R0433:Cfap54 UTSW 10 92,814,942 (GRCm39) splice site probably benign
R0436:Cfap54 UTSW 10 92,874,837 (GRCm39) missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92,710,805 (GRCm39) critical splice donor site probably null
R0523:Cfap54 UTSW 10 92,744,745 (GRCm39) utr 3 prime probably benign
R0551:Cfap54 UTSW 10 92,860,984 (GRCm39) missense probably benign 0.35
R0595:Cfap54 UTSW 10 92,720,598 (GRCm39) missense unknown
R0617:Cfap54 UTSW 10 92,665,512 (GRCm39) splice site probably benign
R0632:Cfap54 UTSW 10 92,720,958 (GRCm39) missense unknown
R0730:Cfap54 UTSW 10 92,870,599 (GRCm39) missense probably benign 0.05
R0786:Cfap54 UTSW 10 92,803,397 (GRCm39) missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92,706,531 (GRCm39) missense unknown
R1004:Cfap54 UTSW 10 92,902,558 (GRCm39) splice site probably benign
R1033:Cfap54 UTSW 10 92,675,311 (GRCm39) missense probably benign 0.07
R1168:Cfap54 UTSW 10 92,773,782 (GRCm39) missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92,711,856 (GRCm39) missense unknown
R1429:Cfap54 UTSW 10 92,656,900 (GRCm39) missense probably benign 0.01
R1443:Cfap54 UTSW 10 92,768,583 (GRCm39) missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1467:Cfap54 UTSW 10 92,805,625 (GRCm39) missense probably benign 0.01
R1557:Cfap54 UTSW 10 92,820,089 (GRCm39) missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92,768,502 (GRCm39) missense probably damaging 1.00
R1690:Cfap54 UTSW 10 92,871,304 (GRCm39) missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R1756:Cfap54 UTSW 10 92,883,923 (GRCm39) missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably null
R1835:Cfap54 UTSW 10 92,798,237 (GRCm39) missense probably benign 0.35
R1889:Cfap54 UTSW 10 92,870,572 (GRCm39) missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92,720,564 (GRCm39) missense unknown
R1958:Cfap54 UTSW 10 92,833,204 (GRCm39) missense probably benign 0.18
R2005:Cfap54 UTSW 10 92,720,630 (GRCm39) missense unknown
R2045:Cfap54 UTSW 10 92,874,671 (GRCm39) splice site probably null
R2059:Cfap54 UTSW 10 92,778,841 (GRCm39) unclassified probably benign
R2100:Cfap54 UTSW 10 92,837,799 (GRCm39) missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92,722,229 (GRCm39) missense unknown
R2392:Cfap54 UTSW 10 92,860,873 (GRCm39) critical splice donor site probably null
R2508:Cfap54 UTSW 10 92,833,236 (GRCm39) missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92,776,017 (GRCm39) missense probably damaging 1.00
R2857:Cfap54 UTSW 10 92,881,144 (GRCm39) missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92,757,281 (GRCm39) missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3108:Cfap54 UTSW 10 92,830,545 (GRCm39) missense probably benign 0.04
R3157:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3158:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3159:Cfap54 UTSW 10 92,834,918 (GRCm39) missense probably benign 0.03
R3161:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3162:Cfap54 UTSW 10 92,881,140 (GRCm39) missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92,721,286 (GRCm39) missense unknown
R3730:Cfap54 UTSW 10 92,847,335 (GRCm39) nonsense probably null
R3770:Cfap54 UTSW 10 92,714,398 (GRCm39) missense unknown
R3776:Cfap54 UTSW 10 92,880,962 (GRCm39) missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92,740,206 (GRCm39) utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92,778,735 (GRCm39) unclassified probably benign
R3834:Cfap54 UTSW 10 92,636,985 (GRCm39) splice site probably benign
R3891:Cfap54 UTSW 10 92,874,708 (GRCm39) missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92,665,619 (GRCm39) missense probably benign 0.03
R3973:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92,675,333 (GRCm39) missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R4190:Cfap54 UTSW 10 92,720,885 (GRCm39) missense unknown
R4389:Cfap54 UTSW 10 92,803,362 (GRCm39) missense probably benign 0.37
R4542:Cfap54 UTSW 10 92,860,991 (GRCm39) missense probably benign 0.12
R4564:Cfap54 UTSW 10 92,675,402 (GRCm39) unclassified probably benign
R4576:Cfap54 UTSW 10 92,879,090 (GRCm39) critical splice donor site probably null
R4620:Cfap54 UTSW 10 92,805,619 (GRCm39) missense probably benign 0.01
R4714:Cfap54 UTSW 10 92,651,780 (GRCm39) missense probably benign 0.01
R4762:Cfap54 UTSW 10 92,897,315 (GRCm39) splice site probably null
R4776:Cfap54 UTSW 10 92,808,556 (GRCm39) missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92,672,339 (GRCm39) nonsense probably null
R4827:Cfap54 UTSW 10 92,737,937 (GRCm39) utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92,803,390 (GRCm39) missense probably benign 0.01
R4965:Cfap54 UTSW 10 92,902,661 (GRCm39) missense probably benign 0.23
R5001:Cfap54 UTSW 10 92,800,396 (GRCm39) missense probably benign 0.01
R5060:Cfap54 UTSW 10 92,875,013 (GRCm39) missense probably damaging 1.00
R5067:Cfap54 UTSW 10 92,902,628 (GRCm39) missense probably benign 0.17
R5069:Cfap54 UTSW 10 92,773,636 (GRCm39) missense probably benign
R5094:Cfap54 UTSW 10 92,734,861 (GRCm39) utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92,773,753 (GRCm39) missense probably benign 0.03
R5127:Cfap54 UTSW 10 92,722,249 (GRCm39) splice site probably null
R5143:Cfap54 UTSW 10 92,865,020 (GRCm39) missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92,773,700 (GRCm39) missense probably benign 0.00
R5158:Cfap54 UTSW 10 92,901,059 (GRCm39) missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92,880,885 (GRCm39) splice site probably null
R5256:Cfap54 UTSW 10 92,770,953 (GRCm39) nonsense probably null
R5266:Cfap54 UTSW 10 92,651,764 (GRCm39) missense probably benign 0.16
R5304:Cfap54 UTSW 10 92,656,968 (GRCm39) missense probably damaging 0.97
R5369:Cfap54 UTSW 10 92,897,119 (GRCm39) intron probably benign
R5406:Cfap54 UTSW 10 92,837,720 (GRCm39) missense probably benign 0.33
R5471:Cfap54 UTSW 10 92,864,522 (GRCm39) missense probably damaging 1.00
R5485:Cfap54 UTSW 10 92,864,979 (GRCm39) missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92,808,470 (GRCm39) missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92,808,473 (GRCm39) nonsense probably null
R5614:Cfap54 UTSW 10 92,880,911 (GRCm39) missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92,740,125 (GRCm39) critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92,814,879 (GRCm39) nonsense probably null
R5797:Cfap54 UTSW 10 92,803,438 (GRCm39) missense probably benign 0.11
R5859:Cfap54 UTSW 10 92,852,386 (GRCm39) nonsense probably null
R5878:Cfap54 UTSW 10 92,800,423 (GRCm39) missense probably benign 0.01
R5910:Cfap54 UTSW 10 92,901,043 (GRCm39) missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92,798,274 (GRCm39) missense probably benign 0.01
R5994:Cfap54 UTSW 10 92,874,943 (GRCm39) missense probably damaging 0.99
R6080:Cfap54 UTSW 10 92,881,197 (GRCm39) missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 92,874,771 (GRCm39) missense probably damaging 1.00
R6296:Cfap54 UTSW 10 92,902,708 (GRCm39) missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92,803,354 (GRCm39) missense probably benign 0.04
R6545:Cfap54 UTSW 10 92,672,319 (GRCm39) missense probably benign 0.31
R6570:Cfap54 UTSW 10 92,651,820 (GRCm39) missense unknown
R6597:Cfap54 UTSW 10 92,834,902 (GRCm39) missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6703:Cfap54 UTSW 10 92,704,596 (GRCm39) missense unknown
R6720:Cfap54 UTSW 10 92,656,981 (GRCm39) missense probably benign 0.07
R6841:Cfap54 UTSW 10 92,710,877 (GRCm39) missense unknown
R6910:Cfap54 UTSW 10 92,672,374 (GRCm39) missense probably benign 0.29
R6953:Cfap54 UTSW 10 92,830,540 (GRCm39) missense probably benign 0.19
R7009:Cfap54 UTSW 10 92,710,881 (GRCm39) missense unknown
R7129:Cfap54 UTSW 10 92,852,433 (GRCm39) missense probably benign 0.06
R7131:Cfap54 UTSW 10 92,656,966 (GRCm39) missense probably benign 0.03
R7171:Cfap54 UTSW 10 92,612,072 (GRCm39) missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92,773,590 (GRCm39) missense unknown
R7225:Cfap54 UTSW 10 92,740,236 (GRCm39) missense unknown
R7270:Cfap54 UTSW 10 92,675,320 (GRCm39) missense probably benign 0.03
R7323:Cfap54 UTSW 10 92,637,000 (GRCm39) missense probably benign 0.00
R7380:Cfap54 UTSW 10 92,883,840 (GRCm39) missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92,720,565 (GRCm39) missense unknown
R7411:Cfap54 UTSW 10 92,704,617 (GRCm39) missense unknown
R7503:Cfap54 UTSW 10 92,723,298 (GRCm39) splice site probably null
R7622:Cfap54 UTSW 10 92,792,806 (GRCm39) missense unknown
R7679:Cfap54 UTSW 10 92,803,374 (GRCm39) missense probably benign 0.01
R7776:Cfap54 UTSW 10 92,704,603 (GRCm39) missense unknown
R7844:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R7980:Cfap54 UTSW 10 92,817,922 (GRCm39) missense possibly damaging 0.95
R7988:Cfap54 UTSW 10 92,737,941 (GRCm39) missense unknown
R8101:Cfap54 UTSW 10 92,720,658 (GRCm39) missense unknown
R8119:Cfap54 UTSW 10 92,704,672 (GRCm39) missense unknown
R8134:Cfap54 UTSW 10 92,714,378 (GRCm39) missense unknown
R8168:Cfap54 UTSW 10 92,744,739 (GRCm39) missense unknown
R8179:Cfap54 UTSW 10 92,833,178 (GRCm39) missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92,798,279 (GRCm39) missense unknown
R8436:Cfap54 UTSW 10 92,800,398 (GRCm39) missense unknown
R8505:Cfap54 UTSW 10 92,814,855 (GRCm39) missense probably benign 0.03
R8671:Cfap54 UTSW 10 92,790,934 (GRCm39) missense unknown
R8716:Cfap54 UTSW 10 92,800,494 (GRCm39) missense probably benign 0.00
R8816:Cfap54 UTSW 10 92,714,454 (GRCm39) missense unknown
R8822:Cfap54 UTSW 10 92,875,003 (GRCm39) missense probably benign 0.09
R8827:Cfap54 UTSW 10 92,774,110 (GRCm39) missense unknown
R8920:Cfap54 UTSW 10 92,776,199 (GRCm39) critical splice acceptor site probably null
R8924:Cfap54 UTSW 10 92,837,685 (GRCm39) missense probably damaging 0.99
R8954:Cfap54 UTSW 10 92,879,255 (GRCm39) missense probably damaging 1.00
R8963:Cfap54 UTSW 10 92,864,562 (GRCm39) nonsense probably null
R9010:Cfap54 UTSW 10 92,734,921 (GRCm39) missense unknown
R9017:Cfap54 UTSW 10 92,651,883 (GRCm39) missense probably benign 0.07
R9093:Cfap54 UTSW 10 92,651,770 (GRCm39) missense probably benign 0.03
R9095:Cfap54 UTSW 10 92,846,882 (GRCm39) missense probably damaging 1.00
R9142:Cfap54 UTSW 10 92,820,097 (GRCm39) missense possibly damaging 0.87
R9178:Cfap54 UTSW 10 92,830,579 (GRCm39) missense probably benign 0.10
R9196:Cfap54 UTSW 10 92,873,753 (GRCm39) missense probably benign 0.22
R9203:Cfap54 UTSW 10 92,880,990 (GRCm39) missense probably benign 0.30
R9258:Cfap54 UTSW 10 92,770,960 (GRCm39) missense unknown
R9275:Cfap54 UTSW 10 92,875,048 (GRCm39) missense possibly damaging 0.86
R9287:Cfap54 UTSW 10 92,805,565 (GRCm39) missense possibly damaging 0.50
R9289:Cfap54 UTSW 10 92,656,936 (GRCm39) missense possibly damaging 0.83
R9310:Cfap54 UTSW 10 92,798,177 (GRCm39) missense unknown
R9397:Cfap54 UTSW 10 92,833,147 (GRCm39) missense probably damaging 0.96
R9462:Cfap54 UTSW 10 92,737,920 (GRCm39) missense unknown
R9697:Cfap54 UTSW 10 92,792,851 (GRCm39) missense unknown
R9746:Cfap54 UTSW 10 92,637,081 (GRCm39) missense probably benign 0.03
R9755:Cfap54 UTSW 10 92,757,230 (GRCm39) missense unknown
X0022:Cfap54 UTSW 10 92,768,476 (GRCm39) missense probably damaging 1.00
X0022:Cfap54 UTSW 10 92,714,465 (GRCm39) missense unknown
X0027:Cfap54 UTSW 10 92,837,750 (GRCm39) missense possibly damaging 0.86
X0027:Cfap54 UTSW 10 92,714,400 (GRCm39) missense unknown
Z1177:Cfap54 UTSW 10 92,814,888 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACCTCTGAGATGAACGGCG -3'
(R):5'- TTAGACATACGCGTCTGTTTCC -3'

Sequencing Primer
(F):5'- GCGGGCTTCAGGGTCAC -3'
(R):5'- GCGTCTGTTTCCATCGAAGACG -3'
Posted On 2014-08-25