Incidental Mutation 'R2004:Pdlim2'
ID 223476
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 040013-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2004 (G1)
Quality Score 136
Status Not validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70402228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 296 (R296H)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: R97H
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: R97H

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Meta Mutation Damage Score 0.8007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,092,561 (GRCm39) Y146* probably null Het
Adcy2 A G 13: 68,944,722 (GRCm39) L220P probably damaging Het
Agl T C 3: 116,574,914 (GRCm39) Y660C probably damaging Het
Ak1 A G 2: 32,519,622 (GRCm39) T17A probably benign Het
Amph G A 13: 19,326,198 (GRCm39) V643M probably damaging Het
Ankrd11 A T 8: 123,629,161 (GRCm39) probably null Het
Ap5b1 T C 19: 5,620,502 (GRCm39) S641P possibly damaging Het
Apoc4 A G 7: 19,415,304 (GRCm39) M1T probably null Het
Arhgap5 T C 12: 52,564,817 (GRCm39) V596A probably benign Het
Ascc3 A G 10: 50,493,838 (GRCm39) E91G probably damaging Het
Bach2 T A 4: 32,580,055 (GRCm39) V637E probably benign Het
Bicd2 T G 13: 49,532,881 (GRCm39) L489R possibly damaging Het
Bltp1 C T 3: 36,949,527 (GRCm39) T2I possibly damaging Het
Boc A T 16: 44,322,007 (GRCm39) probably null Het
Cbln2 T A 18: 86,734,791 (GRCm39) V188D probably damaging Het
Ccl11 A C 11: 81,953,123 (GRCm39) T94P probably damaging Het
Cd109 A T 9: 78,611,044 (GRCm39) H1220L probably benign Het
Cd226 A G 18: 89,265,435 (GRCm39) I125V probably benign Het
Cep135 T A 5: 76,780,176 (GRCm39) probably null Het
Cgnl1 T G 9: 71,537,821 (GRCm39) E1233A probably damaging Het
Ckap5 T A 2: 91,437,891 (GRCm39) D1597E possibly damaging Het
Clptm1 A G 7: 19,380,762 (GRCm39) I63T possibly damaging Het
Cpsf7 C T 19: 10,518,073 (GRCm39) P428S probably damaging Het
Cuedc1 C T 11: 88,068,216 (GRCm39) P155S probably damaging Het
Dgkb T C 12: 38,134,228 (GRCm39) Y45H probably damaging Het
Dglucy T C 12: 100,823,181 (GRCm39) F459L probably damaging Het
Dmp1 T A 5: 104,359,790 (GRCm39) D155E possibly damaging Het
Dnah1 T A 14: 31,023,813 (GRCm39) I960F possibly damaging Het
Drosha G T 15: 12,915,467 (GRCm39) M795I probably damaging Het
Dsg1b A G 18: 20,529,532 (GRCm39) T326A probably damaging Het
Dusp16 T G 6: 134,695,802 (GRCm39) N343T probably benign Het
Faim2 T C 15: 99,398,127 (GRCm39) S274G possibly damaging Het
Fhip2a G T 19: 57,370,324 (GRCm39) V523L probably benign Het
Fndc1 T C 17: 8,023,761 (GRCm39) R65G probably damaging Het
Fnip2 A T 3: 79,419,632 (GRCm39) probably benign Het
Grm3 T C 5: 9,639,793 (GRCm39) Y84C possibly damaging Het
Herc2 T C 7: 55,787,607 (GRCm39) F1755L probably damaging Het
Hivep1 C T 13: 42,313,625 (GRCm39) T1955I possibly damaging Het
Ift20 T C 11: 78,431,797 (GRCm39) I97T probably damaging Het
Il36rn T C 2: 24,171,376 (GRCm39) C155R probably damaging Het
Lca5l T A 16: 95,963,849 (GRCm39) K358N probably damaging Het
Lca5l T C 16: 95,977,218 (GRCm39) N196S possibly damaging Het
Maf1 G A 15: 76,237,563 (GRCm39) D175N probably damaging Het
Mical3 T C 6: 120,928,283 (GRCm39) K996E probably damaging Het
Midn A G 10: 79,990,983 (GRCm39) N331S probably benign Het
Mki67 T A 7: 135,300,238 (GRCm39) K1599* probably null Het
Mlx A G 11: 100,979,805 (GRCm39) Q162R possibly damaging Het
Nalf1 A G 8: 9,820,607 (GRCm39) S138P probably benign Het
Ngp T C 9: 110,249,929 (GRCm39) C76R probably damaging Het
Nin C T 12: 70,072,251 (GRCm39) G1210D probably benign Het
Nlgn1 A G 3: 25,488,034 (GRCm39) I738T probably benign Het
Nop53 A C 7: 15,672,153 (GRCm39) F465C probably damaging Het
Npas3 A G 12: 54,114,680 (GRCm39) D503G possibly damaging Het
Npbwr1 T A 1: 5,986,570 (GRCm39) S315C probably damaging Het
Nup42 G T 5: 24,386,989 (GRCm39) G260* probably null Het
Ogdh G C 11: 6,284,626 (GRCm39) R200P possibly damaging Het
Or4b13 T A 2: 90,083,036 (GRCm39) I99L probably benign Het
Or52n20 A G 7: 104,320,808 (GRCm39) T300A possibly damaging Het
Or5m13b T G 2: 85,753,939 (GRCm39) probably null Het
Or6ae1 C T 7: 139,742,729 (GRCm39) V45I probably damaging Het
Or7g16 G A 9: 18,726,801 (GRCm39) S263L probably benign Het
Or7g33 A T 9: 19,448,688 (GRCm39) C179* probably null Het
Ovgp1 T A 3: 105,894,309 (GRCm39) probably benign Het
Papln T A 12: 83,819,992 (GRCm39) C150S probably damaging Het
Pde1c A T 6: 56,135,996 (GRCm39) L316Q probably damaging Het
Piezo2 G T 18: 63,277,997 (GRCm39) D302E probably damaging Het
Pirb A T 7: 3,720,637 (GRCm39) L287Q probably benign Het
Plin1 A G 7: 79,375,378 (GRCm39) probably benign Het
Plxnc1 A G 10: 94,688,484 (GRCm39) I698T probably damaging Het
Ppp1r12c G T 7: 4,485,974 (GRCm39) C572* probably null Het
Ptgis T C 2: 167,056,769 (GRCm39) M273V possibly damaging Het
Samd14 C A 11: 94,914,110 (GRCm39) T283K probably damaging Het
Scnn1g A T 7: 121,337,411 (GRCm39) K91* probably null Het
Slc24a4 A G 12: 102,180,166 (GRCm39) Q95R probably damaging Het
Slfn9 T G 11: 82,879,027 (GRCm39) D34A probably benign Het
Smarca4 A T 9: 21,588,776 (GRCm39) I1193F probably damaging Het
Spata31e5 A G 1: 28,816,260 (GRCm39) W591R probably damaging Het
Sphkap T C 1: 83,255,632 (GRCm39) M706V probably benign Het
Stard9 C A 2: 120,504,117 (GRCm39) S221R probably damaging Het
Stxbp1 T C 2: 32,688,201 (GRCm39) D488G probably damaging Het
Sugp2 C T 8: 70,695,306 (GRCm39) probably null Het
Tekt5 T C 16: 10,213,070 (GRCm39) I72V probably benign Het
Themis T A 10: 28,658,720 (GRCm39) N582K probably benign Het
Tmed11 C A 5: 108,934,000 (GRCm39) M65I possibly damaging Het
Top3a G T 11: 60,633,315 (GRCm39) P927Q probably damaging Het
Trpa1 A T 1: 14,976,207 (GRCm39) N165K possibly damaging Het
Tsfm A G 10: 126,866,663 (GRCm39) S2P probably damaging Het
Wdr47 C A 3: 108,534,758 (GRCm39) S559* probably null Het
Wnt2b T C 3: 104,860,331 (GRCm39) Y192C probably damaging Het
Zfp280b A G 10: 75,874,370 (GRCm39) D83G probably benign Het
Zfp345 T C 2: 150,314,038 (GRCm39) T500A possibly damaging Het
Zfp78 T A 7: 6,382,074 (GRCm39) C343S probably damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTCAGTATAATCATGTCTGCAG -3'
(R):5'- GGGGTTGGTAAAATGAAATTCCTG -3'

Sequencing Primer
(F):5'- AATCATGTCTGCAGAGTCTGAG -3'
(R):5'- AAATTCCTGAGAGAGAGGCTTTTG -3'
Posted On 2014-08-25