Incidental Mutation 'R2004:Dsg1b'
ID223495
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2004 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20396475 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 326 (T326A)
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably damaging
Transcript: ENSMUST00000076737
AA Change: T326A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928
AA Change: T326A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Piezo2 G T 18: 63,144,926 D302E probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7940:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7990:Dsg1b UTSW 18 20405210 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCTCTTGTTCCAGTATGACATCG -3'
(R):5'- GAAATGCTTTCCCCAAACCTG -3'

Sequencing Primer
(F):5'- CTTGTTCCAGTATGACATCGAAATTG -3'
(R):5'- ACCTGATGTTTGGAAAGAATTGC -3'
Posted On2014-08-25