Incidental Mutation 'R2004:Piezo2'
ID 223497
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 040013-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2004 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 63144926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 302 (D302E)
Ref Sequence ENSEMBL: ENSMUSP00000138758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046860
AA Change: D302E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482
AA Change: D302E

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: D302E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: D302E

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182166
AA Change: D194E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182177
Predicted Effect possibly damaging
Transcript: ENSMUST00000182233
AA Change: D70E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: D70E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183217
AA Change: D302E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: D302E

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,895,378 T2I possibly damaging Het
Aass A T 6: 23,092,562 Y146* probably null Het
Adcy2 A G 13: 68,796,603 L220P probably damaging Het
Agl T C 3: 116,781,265 Y660C probably damaging Het
Ak1 A G 2: 32,629,610 T17A probably benign Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Ankrd11 A T 8: 122,902,422 probably null Het
Ap5b1 T C 19: 5,570,474 S641P possibly damaging Het
Apoc4 A G 7: 19,681,379 M1T probably null Het
Arhgap5 T C 12: 52,518,034 V596A probably benign Het
Ascc3 A G 10: 50,617,742 E91G probably damaging Het
Bach2 T A 4: 32,580,055 V637E probably benign Het
Bicd2 T G 13: 49,379,405 L489R possibly damaging Het
Boc A T 16: 44,501,644 probably null Het
Cbln2 T A 18: 86,716,666 V188D probably damaging Het
Ccl11 A C 11: 82,062,297 T94P probably damaging Het
Cd109 A T 9: 78,703,762 H1220L probably benign Het
Cd226 A G 18: 89,247,311 I125V probably benign Het
Cep135 T A 5: 76,632,329 probably null Het
Cgnl1 T G 9: 71,630,539 E1233A probably damaging Het
Ckap5 T A 2: 91,607,546 D1597E possibly damaging Het
Clptm1 A G 7: 19,646,837 I63T possibly damaging Het
Cpsf7 C T 19: 10,540,709 P428S probably damaging Het
Cuedc1 C T 11: 88,177,390 P155S probably damaging Het
Dgkb T C 12: 38,084,229 Y45H probably damaging Het
Dglucy T C 12: 100,856,922 F459L probably damaging Het
Dmp1 T A 5: 104,211,924 D155E possibly damaging Het
Dnah1 T A 14: 31,301,856 I960F possibly damaging Het
Drosha G T 15: 12,915,381 M795I probably damaging Het
Dsg1b A G 18: 20,396,475 T326A probably damaging Het
Dusp16 T G 6: 134,718,839 N343T probably benign Het
Faim2 T C 15: 99,500,246 S274G possibly damaging Het
Fam155a A G 8: 9,770,607 S138P probably benign Het
Fam160b1 G T 19: 57,381,892 V523L probably benign Het
Fndc1 T C 17: 7,804,929 R65G probably damaging Het
Fnip2 A T 3: 79,512,325 probably benign Het
Gm597 A G 1: 28,777,179 W591R probably damaging Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Herc2 T C 7: 56,137,859 F1755L probably damaging Het
Hivep1 C T 13: 42,160,149 T1955I possibly damaging Het
Ift20 T C 11: 78,540,971 I97T probably damaging Het
Il1f5 T C 2: 24,281,364 C155R probably damaging Het
Lca5l T A 16: 96,162,649 K358N probably damaging Het
Lca5l T C 16: 96,176,018 N196S possibly damaging Het
Maf1 G A 15: 76,353,363 D175N probably damaging Het
Mical3 T C 6: 120,951,322 K996E probably damaging Het
Midn A G 10: 80,155,149 N331S probably benign Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mlx A G 11: 101,088,979 Q162R possibly damaging Het
Ngp T C 9: 110,420,861 C76R probably damaging Het
Nin C T 12: 70,025,477 G1210D probably benign Het
Nlgn1 A G 3: 25,433,870 I738T probably benign Het
Nop53 A C 7: 15,938,228 F465C probably damaging Het
Npas3 A G 12: 54,067,897 D503G possibly damaging Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Nupl2 G T 5: 24,181,991 G260* probably null Het
Ogdh G C 11: 6,334,626 R200P possibly damaging Het
Olfr1026 T G 2: 85,923,595 probably null Het
Olfr142 T A 2: 90,252,692 I99L probably benign Het
Olfr522 C T 7: 140,162,816 V45I probably damaging Het
Olfr659 A G 7: 104,671,601 T300A possibly damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Olfr853 A T 9: 19,537,392 C179* probably null Het
Ovgp1 T A 3: 105,986,993 probably benign Het
Papln T A 12: 83,773,218 C150S probably damaging Het
Pde1c A T 6: 56,159,011 L316Q probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin1 A G 7: 79,725,630 probably benign Het
Plxnc1 A G 10: 94,852,622 I698T probably damaging Het
Ppp1r12c G T 7: 4,482,975 C572* probably null Het
Ptgis T C 2: 167,214,849 M273V possibly damaging Het
Samd14 C A 11: 95,023,284 T283K probably damaging Het
Scnn1g A T 7: 121,738,188 K91* probably null Het
Slc24a4 A G 12: 102,213,907 Q95R probably damaging Het
Slfn9 T G 11: 82,988,201 D34A probably benign Het
Smarca4 A T 9: 21,677,480 I1193F probably damaging Het
Sphkap T C 1: 83,277,911 M706V probably benign Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stxbp1 T C 2: 32,798,189 D488G probably damaging Het
Sugp2 C T 8: 70,242,656 probably null Het
Tekt5 T C 16: 10,395,206 I72V probably benign Het
Themis T A 10: 28,782,724 N582K probably benign Het
Tmed11 C A 5: 108,786,134 M65I possibly damaging Het
Top3a G T 11: 60,742,489 P927Q probably damaging Het
Trpa1 A T 1: 14,905,983 N165K possibly damaging Het
Tsfm A G 10: 127,030,794 S2P probably damaging Het
Wdr47 C A 3: 108,627,442 S559* probably null Het
Wnt2b T C 3: 104,953,015 Y192C probably damaging Het
Zfp280b A G 10: 76,038,536 D83G probably benign Het
Zfp345 T C 2: 150,472,118 T500A possibly damaging Het
Zfp78 T A 7: 6,379,075 C343S probably damaging Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
sopranino UTSW 18 63024466 missense probably damaging 1.00
woodwind UTSW 18 63124642 missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
R7829:Piezo2 UTSW 18 63113876 critical splice donor site probably null
R7835:Piezo2 UTSW 18 63082945 missense probably benign 0.12
R8014:Piezo2 UTSW 18 63083200 missense probably benign 0.02
R8055:Piezo2 UTSW 18 63042811 missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63030466 missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63075730 missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63012786 missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63084688 missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63045540 missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63146802 missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63092900 nonsense probably null
R8708:Piezo2 UTSW 18 63093015 missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63109885 missense probably benign
R8727:Piezo2 UTSW 18 63109885 missense probably benign
R8810:Piezo2 UTSW 18 63114963 missense probably benign 0.41
R8900:Piezo2 UTSW 18 63115025 missense probably benign 0.04
R9037:Piezo2 UTSW 18 63092831 missense probably benign 0.31
R9079:Piezo2 UTSW 18 63024466 missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9125:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9171:Piezo2 UTSW 18 63045479 missense probably benign 0.04
R9194:Piezo2 UTSW 18 63117744 missense probably benign 0.03
R9203:Piezo2 UTSW 18 63157231 missense probably benign 0.00
R9209:Piezo2 UTSW 18 63021301 missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63075797 missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63024566 missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63029085 missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63032962 missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63102165 missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63032962 missense possibly damaging 0.67
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGCAGCACCTTTATTCCAG -3'
(R):5'- CTTTGACCTCGGCTGTGTAC -3'

Sequencing Primer
(F):5'- TCTCGACTGTGTTGTCAATAAAACC -3'
(R):5'- GACCTCGGCTGTGTACTTCTTTG -3'
Posted On 2014-08-25