Incidental Mutation 'R1992:Hjurp'
ID 223519
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission 040003-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R1992 (G1)
Quality Score 217
Status Not validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) GT to GTT at 88194246 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik T C 1: 138,781,380 (GRCm39) T90A probably damaging Het
A930011G23Rik T C 5: 99,381,784 (GRCm39) D326G possibly damaging Het
Abcc2 A T 19: 43,795,581 (GRCm39) I446F probably damaging Het
Adam34l T C 8: 44,080,176 (GRCm39) K16R probably benign Het
Adamts14 A G 10: 61,034,439 (GRCm39) Y1150H probably benign Het
Adgrl2 A G 3: 148,522,880 (GRCm39) I217T possibly damaging Het
Afap1l1 A T 18: 61,874,842 (GRCm39) Y446* probably null Het
Aimp2 G A 5: 143,843,548 (GRCm39) A14V probably damaging Het
Akap8 G A 17: 32,535,586 (GRCm39) H143Y probably damaging Het
Aldh2 A T 5: 121,714,026 (GRCm39) V207E possibly damaging Het
Aoc1l2 T A 6: 48,907,703 (GRCm39) H234Q probably damaging Het
Armc3 T C 2: 19,297,953 (GRCm39) Y575H probably damaging Het
Arpp21 T C 9: 111,986,861 (GRCm39) E230G probably damaging Het
Arrdc3 G A 13: 81,031,808 (GRCm39) D14N probably damaging Het
Atn1 A G 6: 124,722,291 (GRCm39) probably benign Het
Atxn7l1 G A 12: 33,408,743 (GRCm39) D302N probably damaging Het
Bbs1 T A 19: 4,941,736 (GRCm39) H518L probably benign Het
Bltp1 A T 3: 37,054,181 (GRCm39) H3100L probably benign Het
Bmpr1a C A 14: 34,147,050 (GRCm39) G241C probably damaging Het
Cacna1b G A 2: 24,622,318 (GRCm39) P222L probably damaging Het
Calcrl T C 2: 84,200,855 (GRCm39) Y63C probably damaging Het
Cand2 A G 6: 115,762,093 (GRCm39) H173R possibly damaging Het
Cap2 T A 13: 46,791,357 (GRCm39) Y175N possibly damaging Het
Card14 A T 11: 119,212,647 (GRCm39) probably null Het
Cd3d T A 9: 44,896,299 (GRCm39) Y29* probably null Het
Cd4 A G 6: 124,844,651 (GRCm39) V378A possibly damaging Het
Cluh A T 11: 74,550,828 (GRCm39) H318L probably damaging Het
Clvs1 T A 4: 9,281,899 (GRCm39) D114E probably benign Het
Cnot4 T A 6: 35,000,344 (GRCm39) T548S probably benign Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Cr2 G A 1: 194,836,458 (GRCm39) P1278S possibly damaging Het
Crebbp A T 16: 3,946,561 (GRCm39) probably null Het
Dnah7a T G 1: 53,621,835 (GRCm39) K1097Q possibly damaging Het
Doc2a T A 7: 126,450,979 (GRCm39) probably null Het
Dpp10 A T 1: 123,832,833 (GRCm39) V48E probably null Het
Dsg2 A G 18: 20,734,530 (GRCm39) K836R probably damaging Het
Egr2 T C 10: 67,375,857 (GRCm39) V164A probably damaging Het
Erbin A T 13: 103,970,221 (GRCm39) S1132T probably benign Het
Espn T A 4: 152,213,012 (GRCm39) probably null Het
Fam83b A G 9: 76,399,304 (GRCm39) S600P probably benign Het
Fanca A T 8: 124,024,551 (GRCm39) N425K possibly damaging Het
Flot2 C T 11: 77,949,445 (GRCm39) L294F probably damaging Het
Frs2 A G 10: 116,910,459 (GRCm39) V301A probably benign Het
Fv1 T A 4: 147,953,618 (GRCm39) N61K possibly damaging Het
Fxr2 A G 11: 69,540,659 (GRCm39) E339G possibly damaging Het
Gck T C 11: 5,856,515 (GRCm39) Y214C probably damaging Het
Golga3 C G 5: 110,340,839 (GRCm39) T551R probably damaging Het
Gorab A G 1: 163,224,625 (GRCm39) S59P probably damaging Het
Gsdme C T 6: 50,185,102 (GRCm39) V451M probably damaging Het
H2-T13 A C 17: 36,391,938 (GRCm39) I216S probably damaging Het
Herc4 T A 10: 63,081,743 (GRCm39) V22E possibly damaging Het
Hoxa2 A T 6: 52,141,576 (GRCm39) S17T probably damaging Het
Hs3st5 A G 10: 36,708,882 (GRCm39) Y139C probably damaging Het
Ism1 G A 2: 139,587,937 (GRCm39) V221I probably benign Het
Kalrn T G 16: 33,796,108 (GRCm39) L1222F probably damaging Het
Katnip A G 7: 125,419,261 (GRCm39) N476S probably benign Het
Kdm4c A G 4: 74,261,631 (GRCm39) D602G possibly damaging Het
Ktn1 A G 14: 47,932,978 (GRCm39) K711E probably damaging Het
Lce1k A T 3: 92,714,125 (GRCm39) C20S unknown Het
Macf1 A G 4: 123,350,488 (GRCm39) S3792P probably damaging Het
Maml3 C T 3: 51,598,178 (GRCm39) M189I probably benign Het
Mcc C A 18: 44,624,382 (GRCm39) E213* probably null Het
Mep1a T G 17: 43,813,573 (GRCm39) I13L probably benign Het
Mkrn2 G T 6: 115,586,562 (GRCm39) C16F probably damaging Het
Mlh1 C T 9: 111,057,631 (GRCm39) A727T probably damaging Het
Muc21 A T 17: 35,929,600 (GRCm39) S1529T probably benign Het
Naa16 T C 14: 79,593,931 (GRCm39) Y344C probably damaging Het
Nebl T A 2: 17,457,321 (GRCm39) I80F probably damaging Het
Nlrc4 T A 17: 74,752,628 (GRCm39) Y585F probably benign Het
Nrcam A G 12: 44,587,753 (GRCm39) K149R probably damaging Het
Nufip1 T A 14: 76,372,287 (GRCm39) I467N probably damaging Het
Nup133 A G 8: 124,632,960 (GRCm39) I1057T possibly damaging Het
Obscn A T 11: 58,886,653 (GRCm39) probably benign Het
Or10ag52 T A 2: 87,043,588 (GRCm39) C117* probably null Het
Or5k1 A G 16: 58,617,309 (GRCm39) V300A probably benign Het
Or5k14 A C 16: 58,692,874 (GRCm39) I213R probably benign Het
Pi4k2a A T 19: 42,104,377 (GRCm39) I380F probably damaging Het
Piezo2 A T 18: 63,207,733 (GRCm39) L1426Q probably null Het
Pik3cg A T 12: 32,254,024 (GRCm39) D654E possibly damaging Het
Poli G T 18: 70,642,058 (GRCm39) P714Q probably damaging Het
Polr3f A G 2: 144,378,230 (GRCm39) N201D probably benign Het
Prorp A G 12: 55,384,991 (GRCm39) D89G probably damaging Het
Ptprz1 A T 6: 22,959,747 (GRCm39) K81N probably benign Het
Rbm19 T C 5: 120,271,948 (GRCm39) probably null Het
Sec24a C T 11: 51,627,190 (GRCm39) V241I probably benign Het
Sgk3 A G 1: 9,950,567 (GRCm39) T160A possibly damaging Het
Slc1a4 A G 11: 20,254,375 (GRCm39) I497T probably benign Het
Slc26a9 A T 1: 131,690,532 (GRCm39) D512V probably damaging Het
Slc43a3 C T 2: 84,788,084 (GRCm39) R489C probably damaging Het
Slc5a12 T A 2: 110,452,089 (GRCm39) F327L probably benign Het
Slitrk3 A G 3: 72,957,104 (GRCm39) V556A possibly damaging Het
Spata6l A G 19: 28,926,024 (GRCm39) F130L probably damaging Het
Spib T C 7: 44,178,281 (GRCm39) E180G probably benign Het
Spint2 T A 7: 28,958,833 (GRCm39) N128Y probably damaging Het
Spx G A 6: 142,364,245 (GRCm39) G102E probably benign Het
Spz1 T A 13: 92,712,166 (GRCm39) E103D possibly damaging Het
Sstr2 T C 11: 113,515,495 (GRCm39) I138T probably benign Het
Sytl3 T A 17: 7,000,448 (GRCm39) I206N possibly damaging Het
Tcaf2 T C 6: 42,606,791 (GRCm39) T388A probably benign Het
Tdpoz8 G T 3: 92,981,344 (GRCm39) A121S probably benign Het
Thap12 T C 7: 98,365,572 (GRCm39) V580A possibly damaging Het
Tlr5 T A 1: 182,801,912 (GRCm39) D405E probably damaging Het
Tnxb T C 17: 34,890,878 (GRCm39) V407A probably damaging Het
Tpx2 T A 2: 152,732,544 (GRCm39) M606K probably benign Het
Trim43a T G 9: 88,466,312 (GRCm39) L211R probably damaging Het
Trim46 A T 3: 89,145,008 (GRCm39) Y489N probably damaging Het
Ttc28 C T 5: 111,424,188 (GRCm39) S1485L probably benign Het
Ttll8 T C 15: 88,798,654 (GRCm39) T694A probably benign Het
Txnl1 T C 18: 63,812,585 (GRCm39) T70A probably benign Het
Ube3a C T 7: 58,953,535 (GRCm39) A823V probably damaging Het
Ubqln5 C A 7: 103,778,741 (GRCm39) V28F probably damaging Het
Ulk1 T A 5: 110,935,017 (GRCm39) Q972L probably damaging Het
Unc93b1 T C 19: 3,994,062 (GRCm39) Y398H probably benign Het
Usp1 A G 4: 98,822,531 (GRCm39) D615G probably benign Het
Utp15 A G 13: 98,387,420 (GRCm39) C385R probably benign Het
Vmn2r91 T A 17: 18,356,142 (GRCm39) V603D probably damaging Het
Whamm C T 7: 81,241,519 (GRCm39) R277* probably null Het
Wnt8a A G 18: 34,677,937 (GRCm39) D115G probably damaging Het
Yjefn3 A T 8: 70,341,645 (GRCm39) probably null Het
Ywhab A T 2: 163,853,807 (GRCm39) I95F probably damaging Het
Zfp143 C T 7: 109,660,489 (GRCm39) probably benign Het
Zfp607b C G 7: 27,401,949 (GRCm39) T135R possibly damaging Het
Zfp970 A G 2: 177,166,663 (GRCm39) Q79R possibly damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AACTGTCATGGTTTGTGATGCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On 2014-08-25