Incidental Mutation 'R1992:Slc5a12'
ID223551
Institutional Source Beutler Lab
Gene Symbol Slc5a12
Ensembl Gene ENSMUSG00000041644
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 12
SynonymsSMCT2
MMRRC Submission 040003-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1992 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location110597298-110647779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110621744 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 327 (F327L)
Ref Sequence ENSEMBL: ENSMUSP00000106655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045972] [ENSMUST00000111026]
Predicted Effect probably benign
Transcript: ENSMUST00000045972
AA Change: F327L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047340
Gene: ENSMUSG00000041644
AA Change: F327L

DomainStartEndE-ValueType
Pfam:SSF 41 449 6.5e-43 PFAM
transmembrane domain 507 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111026
AA Change: F327L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106655
Gene: ENSMUSG00000041644
AA Change: F327L

DomainStartEndE-ValueType
Pfam:SSF 41 445 6.2e-48 PFAM
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146664
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Normal blood lactate is maintained at about 1.5 mM, and little filtered lactate is excreted in urine. Reabsorption of lactate is mediated by the low-affinity Na(+)-coupled lactate transporter SLC5A12 in the initial part of the proximal tubule and by the high-affinity Na(+)-coupled lactate transporter SLC5A8 (MIM 608044) in the distal proximal tubule (Gopal et al., 2007 [PubMed 17692818]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,338,206 D89G probably damaging Het
1600015I10Rik T A 6: 48,930,769 H234Q probably damaging Het
2310009B15Rik T C 1: 138,853,642 T90A probably damaging Het
4430402I18Rik A G 19: 28,948,624 F130L probably damaging Het
4932438A13Rik A T 3: 37,000,032 H3100L probably benign Het
A930011G23Rik T C 5: 99,233,925 D326G possibly damaging Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrl2 A G 3: 148,817,244 I217T possibly damaging Het
Afap1l1 A T 18: 61,741,771 Y446* probably null Het
Aimp2 G A 5: 143,906,730 A14V probably damaging Het
Akap8 G A 17: 32,316,612 H143Y probably damaging Het
Aldh2 A T 5: 121,575,963 V207E possibly damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Arpp21 T C 9: 112,157,793 E230G probably damaging Het
Arrdc3 G A 13: 80,883,689 D14N probably damaging Het
Atn1 A G 6: 124,745,328 probably benign Het
Atxn7l1 G A 12: 33,358,744 D302N probably damaging Het
Bbs1 T A 19: 4,891,708 H518L probably benign Het
Bmpr1a C A 14: 34,425,093 G241C probably damaging Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Calcrl T C 2: 84,370,511 Y63C probably damaging Het
Cand2 A G 6: 115,785,132 H173R possibly damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Card14 A T 11: 119,321,821 probably null Het
Cd3d T A 9: 44,985,001 Y29* probably null Het
Cd4 A G 6: 124,867,688 V378A possibly damaging Het
Cluh A T 11: 74,660,002 H318L probably damaging Het
Clvs1 T A 4: 9,281,899 D114E probably benign Het
Cnot4 T A 6: 35,023,409 T548S probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crebbp A T 16: 4,128,697 probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dnah7a T G 1: 53,582,676 K1097Q possibly damaging Het
Doc2a T A 7: 126,851,807 probably null Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Egr2 T C 10: 67,540,027 V164A probably damaging Het
Erbin A T 13: 103,833,713 S1132T probably benign Het
Espn T A 4: 152,128,555 probably null Het
Fam83b A G 9: 76,492,022 S600P probably benign Het
Fanca A T 8: 123,297,812 N425K possibly damaging Het
Flot2 C T 11: 78,058,619 L294F probably damaging Het
Frs2 A G 10: 117,074,554 V301A probably benign Het
Fv1 T A 4: 147,869,161 N61K possibly damaging Het
Fxr2 A G 11: 69,649,833 E339G possibly damaging Het
Gck T C 11: 5,906,515 Y214C probably damaging Het
Gm4858 G T 3: 93,074,037 A121S probably benign Het
Gm5346 T C 8: 43,627,139 K16R probably benign Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Golga3 C G 5: 110,192,973 T551R probably damaging Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-Bl A C 17: 36,081,046 I216S probably damaging Het
Herc4 T A 10: 63,245,964 V22E possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A T 6: 52,164,596 S17T probably damaging Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Ism1 G A 2: 139,746,017 V221I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Kdm4c A G 4: 74,343,394 D602G possibly damaging Het
Ktn1 A G 14: 47,695,521 K711E probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Maml3 C T 3: 51,690,757 M189I probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mep1a T G 17: 43,502,682 I13L probably benign Het
Mkrn2 G T 6: 115,609,601 C16F probably damaging Het
Mlh1 C T 9: 111,228,563 A727T probably damaging Het
Naa16 T C 14: 79,356,491 Y344C probably damaging Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nlrc4 T A 17: 74,445,633 Y585F probably benign Het
Nrcam A G 12: 44,540,970 K149R probably damaging Het
Nufip1 T A 14: 76,134,847 I467N probably damaging Het
Nup133 A G 8: 123,906,221 I1057T possibly damaging Het
Obscn A T 11: 58,995,827 probably benign Het
Olfr1113 T A 2: 87,213,244 C117* probably null Het
Olfr173 A G 16: 58,796,946 V300A probably benign Het
Olfr177 A C 16: 58,872,511 I213R probably benign Het
Pi4k2a A T 19: 42,115,938 I380F probably damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pik3cg A T 12: 32,204,025 D654E possibly damaging Het
Poli G T 18: 70,508,987 P714Q probably damaging Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Ptprz1 A T 6: 22,959,748 K81N probably benign Het
Rbm19 T C 5: 120,133,883 probably null Het
Sec24a C T 11: 51,736,363 V241I probably benign Het
Sgk3 A G 1: 9,880,342 T160A possibly damaging Het
Slc1a4 A G 11: 20,304,375 I497T probably benign Het
Slc26a9 A T 1: 131,762,794 D512V probably damaging Het
Slc43a3 C T 2: 84,957,740 R489C probably damaging Het
Slitrk3 A G 3: 73,049,771 V556A possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint2 T A 7: 29,259,408 N128Y probably damaging Het
Spx G A 6: 142,418,519 G102E probably benign Het
Spz1 T A 13: 92,575,658 E103D possibly damaging Het
Sstr2 T C 11: 113,624,669 I138T probably benign Het
Sytl3 T A 17: 6,733,049 I206N possibly damaging Het
Tcaf2 T C 6: 42,629,857 T388A probably benign Het
Thap12 T C 7: 98,716,365 V580A possibly damaging Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim43a T G 9: 88,584,259 L211R probably damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Ttll8 T C 15: 88,914,451 T694A probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ube3a C T 7: 59,303,787 A823V probably damaging Het
Ubqln5 C A 7: 104,129,534 V28F probably damaging Het
Ulk1 T A 5: 110,787,151 Q972L probably damaging Het
Unc93b1 T C 19: 3,944,062 Y398H probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Utp15 A G 13: 98,250,912 C385R probably benign Het
Vmn2r91 T A 17: 18,135,880 V603D probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Yjefn3 A T 8: 69,888,995 probably null Het
Ywhab A T 2: 164,011,887 I95F probably damaging Het
Zfp143 C T 7: 110,061,282 probably benign Het
Zfp607b C G 7: 27,702,524 T135R possibly damaging Het
Zfp970 A G 2: 177,474,870 Q79R possibly damaging Het
Other mutations in Slc5a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc5a12 APN 2 110597822 missense probably damaging 1.00
IGL01337:Slc5a12 APN 2 110620373 nonsense probably null
IGL01830:Slc5a12 APN 2 110597806 missense probably damaging 1.00
IGL02456:Slc5a12 APN 2 110616834 splice site probably benign
IGL02619:Slc5a12 APN 2 110640856 missense probably benign 0.00
IGL02832:Slc5a12 APN 2 110640815 missense probably benign
IGL02890:Slc5a12 APN 2 110624133 splice site probably benign
IGL03058:Slc5a12 APN 2 110640792 missense probably benign 0.23
R0607:Slc5a12 UTSW 2 110632743 missense probably benign 0.30
R1342:Slc5a12 UTSW 2 110617090 splice site probably null
R1532:Slc5a12 UTSW 2 110610138 missense possibly damaging 0.64
R2354:Slc5a12 UTSW 2 110609432 missense probably damaging 0.97
R3830:Slc5a12 UTSW 2 110632736 nonsense probably null
R4728:Slc5a12 UTSW 2 110644424 nonsense probably null
R4822:Slc5a12 UTSW 2 110621740 missense possibly damaging 0.90
R4937:Slc5a12 UTSW 2 110620408 missense probably damaging 1.00
R5860:Slc5a12 UTSW 2 110597624 missense probably benign 0.30
R6075:Slc5a12 UTSW 2 110616747 missense probably damaging 1.00
R6168:Slc5a12 UTSW 2 110616744 missense probably damaging 1.00
R6853:Slc5a12 UTSW 2 110624194 missense probably benign 0.37
R6870:Slc5a12 UTSW 2 110641810 missense probably damaging 0.99
R7014:Slc5a12 UTSW 2 110644364 missense probably benign 0.00
R7135:Slc5a12 UTSW 2 110616714 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCACACACTGAAGAAATACTGGG -3'
(R):5'- GAGTGAGTGTCCAGCTTCTC -3'

Sequencing Primer
(F):5'- GAGCTAACTCTTAACACATCC -3'
(R):5'- CATTGCAGTGGCCACTTAAG -3'
Posted On2014-08-25