Incidental Mutation 'R1992:Slitrk3'
ID223571
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 040003-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R1992 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73049771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 556 (V556A)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059407
AA Change: V556A

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: V556A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000192477
AA Change: V556A

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: V556A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,338,206 D89G probably damaging Het
1600015I10Rik T A 6: 48,930,769 H234Q probably damaging Het
2310009B15Rik T C 1: 138,853,642 T90A probably damaging Het
4430402I18Rik A G 19: 28,948,624 F130L probably damaging Het
4932438A13Rik A T 3: 37,000,032 H3100L probably benign Het
A930011G23Rik T C 5: 99,233,925 D326G possibly damaging Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrl2 A G 3: 148,817,244 I217T possibly damaging Het
Afap1l1 A T 18: 61,741,771 Y446* probably null Het
Aimp2 G A 5: 143,906,730 A14V probably damaging Het
Akap8 G A 17: 32,316,612 H143Y probably damaging Het
Aldh2 A T 5: 121,575,963 V207E possibly damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Arpp21 T C 9: 112,157,793 E230G probably damaging Het
Arrdc3 G A 13: 80,883,689 D14N probably damaging Het
Atn1 A G 6: 124,745,328 probably benign Het
Atxn7l1 G A 12: 33,358,744 D302N probably damaging Het
Bbs1 T A 19: 4,891,708 H518L probably benign Het
Bmpr1a C A 14: 34,425,093 G241C probably damaging Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Calcrl T C 2: 84,370,511 Y63C probably damaging Het
Cand2 A G 6: 115,785,132 H173R possibly damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Card14 A T 11: 119,321,821 probably null Het
Cd3d T A 9: 44,985,001 Y29* probably null Het
Cd4 A G 6: 124,867,688 V378A possibly damaging Het
Cluh A T 11: 74,660,002 H318L probably damaging Het
Clvs1 T A 4: 9,281,899 D114E probably benign Het
Cnot4 T A 6: 35,023,409 T548S probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crebbp A T 16: 4,128,697 probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dnah7a T G 1: 53,582,676 K1097Q possibly damaging Het
Doc2a T A 7: 126,851,807 probably null Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Egr2 T C 10: 67,540,027 V164A probably damaging Het
Erbin A T 13: 103,833,713 S1132T probably benign Het
Espn T A 4: 152,128,555 probably null Het
Fam83b A G 9: 76,492,022 S600P probably benign Het
Fanca A T 8: 123,297,812 N425K possibly damaging Het
Flot2 C T 11: 78,058,619 L294F probably damaging Het
Frs2 A G 10: 117,074,554 V301A probably benign Het
Fv1 T A 4: 147,869,161 N61K possibly damaging Het
Fxr2 A G 11: 69,649,833 E339G possibly damaging Het
Gck T C 11: 5,906,515 Y214C probably damaging Het
Gm4858 G T 3: 93,074,037 A121S probably benign Het
Gm5346 T C 8: 43,627,139 K16R probably benign Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Golga3 C G 5: 110,192,973 T551R probably damaging Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-Bl A C 17: 36,081,046 I216S probably damaging Het
Herc4 T A 10: 63,245,964 V22E possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A T 6: 52,164,596 S17T probably damaging Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Ism1 G A 2: 139,746,017 V221I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Kdm4c A G 4: 74,343,394 D602G possibly damaging Het
Ktn1 A G 14: 47,695,521 K711E probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Maml3 C T 3: 51,690,757 M189I probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mep1a T G 17: 43,502,682 I13L probably benign Het
Mkrn2 G T 6: 115,609,601 C16F probably damaging Het
Mlh1 C T 9: 111,228,563 A727T probably damaging Het
Naa16 T C 14: 79,356,491 Y344C probably damaging Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nlrc4 T A 17: 74,445,633 Y585F probably benign Het
Nrcam A G 12: 44,540,970 K149R probably damaging Het
Nufip1 T A 14: 76,134,847 I467N probably damaging Het
Nup133 A G 8: 123,906,221 I1057T possibly damaging Het
Obscn A T 11: 58,995,827 probably benign Het
Olfr1113 T A 2: 87,213,244 C117* probably null Het
Olfr173 A G 16: 58,796,946 V300A probably benign Het
Olfr177 A C 16: 58,872,511 I213R probably benign Het
Pi4k2a A T 19: 42,115,938 I380F probably damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pik3cg A T 12: 32,204,025 D654E possibly damaging Het
Poli G T 18: 70,508,987 P714Q probably damaging Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Ptprz1 A T 6: 22,959,748 K81N probably benign Het
Rbm19 T C 5: 120,133,883 probably null Het
Sec24a C T 11: 51,736,363 V241I probably benign Het
Sgk3 A G 1: 9,880,342 T160A possibly damaging Het
Slc1a4 A G 11: 20,304,375 I497T probably benign Het
Slc26a9 A T 1: 131,762,794 D512V probably damaging Het
Slc43a3 C T 2: 84,957,740 R489C probably damaging Het
Slc5a12 T A 2: 110,621,744 F327L probably benign Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint2 T A 7: 29,259,408 N128Y probably damaging Het
Spx G A 6: 142,418,519 G102E probably benign Het
Spz1 T A 13: 92,575,658 E103D possibly damaging Het
Sstr2 T C 11: 113,624,669 I138T probably benign Het
Sytl3 T A 17: 6,733,049 I206N possibly damaging Het
Tcaf2 T C 6: 42,629,857 T388A probably benign Het
Thap12 T C 7: 98,716,365 V580A possibly damaging Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim43a T G 9: 88,584,259 L211R probably damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Ttll8 T C 15: 88,914,451 T694A probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ube3a C T 7: 59,303,787 A823V probably damaging Het
Ubqln5 C A 7: 104,129,534 V28F probably damaging Het
Ulk1 T A 5: 110,787,151 Q972L probably damaging Het
Unc93b1 T C 19: 3,944,062 Y398H probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Utp15 A G 13: 98,250,912 C385R probably benign Het
Vmn2r91 T A 17: 18,135,880 V603D probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Yjefn3 A T 8: 69,888,995 probably null Het
Ywhab A T 2: 164,011,887 I95F probably damaging Het
Zfp143 C T 7: 110,061,282 probably benign Het
Zfp607b C G 7: 27,702,524 T135R possibly damaging Het
Zfp970 A G 2: 177,474,870 Q79R possibly damaging Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6123:Slitrk3 UTSW 3 73049762 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTCCAGGTTGGGCAATATG -3'
(R):5'- TCAACGTCATCCGGGAAATC -3'

Sequencing Primer
(F):5'- AATATGCAGCATCTCTGGGC -3'
(R):5'- GTCATCCGGGAAATCCAACCTG -3'
Posted On2014-08-25