Incidental Mutation 'R2019:Hc'
ID223578
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 040028-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R2019 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 35013528 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 1038 (F1038C)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028233
AA Change: F1038C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: F1038C

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Meta Mutation Damage Score 0.2490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
Abcc9 G A 6: 142,675,434 L527F probably damaging Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acpp C T 9: 104,324,702 G81R probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amz1 G T 5: 140,751,964 M326I probably benign Het
Ankrd36 A G 11: 5,689,140 I1351V probably benign Het
Art2b T C 7: 101,579,987 D235G probably benign Het
Ccdc141 A C 2: 77,011,565 I1507M probably damaging Het
Dck A G 5: 88,774,084 Y135C probably damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnttip2 T C 3: 122,280,744 V610A possibly damaging Het
Efhb A G 17: 53,401,477 S722P probably damaging Het
Emx2 A G 19: 59,459,339 S42G probably benign Het
Ermard C T 17: 15,053,265 R371C probably damaging Het
Fat1 T G 8: 45,023,746 I1943S probably damaging Het
Fignl1 T C 11: 11,802,054 K334E probably damaging Het
Fmn1 A C 2: 113,364,480 K175T unknown Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gpalpp1 A T 14: 76,110,691 probably null Het
Ifngr1 A T 10: 19,592,113 M10L probably damaging Het
Irx5 T G 8: 92,358,364 Y61D probably damaging Het
Itgax A G 7: 128,148,526 H1038R probably benign Het
Jag1 C T 2: 137,084,679 E982K probably benign Het
Klhdc9 T C 1: 171,358,941 D309G probably damaging Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Lrpprc A T 17: 84,752,331 L685Q possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mgat5b A G 11: 116,947,348 Y271C probably benign Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myo16 T C 8: 10,376,260 L339P probably benign Het
Neb G T 2: 52,232,276 Y580* probably null Het
Npat A G 9: 53,562,491 K528E probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr350 A T 2: 36,850,406 Y120F possibly damaging Het
Parp8 G A 13: 116,868,432 probably benign Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Phospho1 G A 11: 95,831,106 V201M probably damaging Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Pitpnm1 T C 19: 4,113,641 S1209P probably damaging Het
Pkd1 T A 17: 24,568,684 C20* probably null Het
Prdm5 C A 6: 65,831,356 N95K probably damaging Het
Prkx T C X: 77,765,404 D270G probably damaging Het
Ptgis A G 2: 167,208,279 V310A probably damaging Het
Ptgis G A 2: 167,214,810 Q286* probably null Het
Rpf1 T A 3: 146,521,221 N59I probably damaging Het
Rpl3l A C 17: 24,735,516 probably benign Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Sla T C 15: 66,782,555 Y278C probably damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Tada2b T C 5: 36,483,906 Y51C probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Tgfbrap1 A G 1: 43,054,517 probably null Het
Tmem116 A G 5: 121,489,254 I151M possibly damaging Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Txnrd1 G A 10: 82,877,373 V90I probably benign Het
Unc79 G A 12: 103,171,571 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Wdr59 A G 8: 111,466,793 Y666H probably damaging Het
Wdr95 A G 5: 149,574,148 probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 intron probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTAAGTTAAGCCAAAATGCCTC -3'
(R):5'- TGGTTACGTCCACTTGGGTC -3'

Sequencing Primer
(F):5'- AAGAGAACATGCCGTGGTTTTTC -3'
(R):5'- GGGTCTCTTTTTCTTTCAGGACTGC -3'
Posted On2014-08-25