Incidental Mutation 'R0142:Virma'
ID22359
Institutional Source Beutler Lab
Gene Symbol Virma
Ensembl Gene ENSMUSG00000040720
Gene Namevir like m6A methyltransferase associated
Synonyms1110037F02Rik
MMRRC Submission 038427-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0142 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location11485958-11550684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11548783 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1780 (N1780K)
Ref Sequence ENSEMBL: ENSMUSP00000103943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059914] [ENSMUST00000108307]
Predicted Effect probably benign
Transcript: ENSMUST00000059914
AA Change: N1730K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: N1730K

DomainStartEndE-ValueType
low complexity region 139 153 N/A INTRINSIC
low complexity region 172 198 N/A INTRINSIC
low complexity region 236 267 N/A INTRINSIC
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1224 1232 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
low complexity region 1460 1474 N/A INTRINSIC
low complexity region 1618 1634 N/A INTRINSIC
low complexity region 1684 1697 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
low complexity region 1796 1808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108307
AA Change: N1780K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: N1780K

DomainStartEndE-ValueType
Pfam:VIR_N 5 266 2e-110 PFAM
low complexity region 276 297 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
low complexity region 1058 1070 N/A INTRINSIC
low complexity region 1162 1174 N/A INTRINSIC
low complexity region 1274 1282 N/A INTRINSIC
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1510 1524 N/A INTRINSIC
low complexity region 1668 1684 N/A INTRINSIC
low complexity region 1734 1747 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.6%
Validation Efficiency 92% (61/66)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,718,254 S1347P possibly damaging Het
Abca6 T G 11: 110,188,641 D1229A probably damaging Het
Abhd8 A C 8: 71,461,862 F41V probably damaging Het
Ago4 T G 4: 126,516,932 E222A probably benign Het
Ap3b2 T C 7: 81,473,080 I470V probably damaging Het
Bcl9l C T 9: 44,507,112 T749M probably benign Het
Bicc1 T C 10: 70,925,370 K937E probably damaging Het
Bmi1 G A 2: 18,683,284 probably null Het
Boc A C 16: 44,490,241 I772S probably damaging Het
C2 T A 17: 34,873,528 I178F possibly damaging Het
Cacna1c G T 6: 118,603,882 A1416E probably damaging Het
Chst10 A G 1: 38,871,729 L118P probably damaging Het
Crybg1 G A 10: 43,999,063 T683I possibly damaging Het
Cul5 C T 9: 53,635,050 V314I probably damaging Het
Dnajc17 C A 2: 119,179,934 R211I probably benign Het
Emilin1 A G 5: 30,913,920 T16A probably benign Het
Ercc6l2 A C 13: 63,872,506 probably benign Het
Fsd2 T A 7: 81,559,935 D53V probably damaging Het
Galnt13 A G 2: 55,098,603 D479G probably damaging Het
Grk3 A T 5: 112,915,053 W643R probably damaging Het
Hdgf G A 3: 87,913,109 A4T possibly damaging Het
Hnrnpr T A 4: 136,327,282 V182E probably damaging Het
Ipo13 A C 4: 117,905,569 L279R probably damaging Het
Itga9 C A 9: 118,636,586 N169K probably damaging Het
Jph3 A G 8: 121,753,371 T263A possibly damaging Het
Jph4 G T 14: 55,108,326 Q625K probably benign Het
Kctd3 A C 1: 188,996,398 probably null Het
Kif26b A T 1: 178,915,389 S570C probably damaging Het
Klhl5 G A 5: 65,143,350 W164* probably null Het
Lacc1 A T 14: 77,030,799 H357Q probably benign Het
Lama2 A G 10: 27,187,845 I1316T probably benign Het
Lcp2 C T 11: 34,082,418 P332L probably damaging Het
Map3k6 A T 4: 133,250,946 H1033L probably benign Het
Mfsd2b A G 12: 4,866,234 V252A probably benign Het
Myo16 T A 8: 10,569,790 I1447N probably benign Het
Myo19 G A 11: 84,894,603 R224H probably damaging Het
Myo5a C T 9: 75,160,574 H637Y probably benign Het
Nek10 C T 14: 14,861,560 R539C possibly damaging Het
Nfix A T 8: 84,721,686 V404E probably damaging Het
Nr1i2 T C 16: 38,253,006 R203G probably benign Het
Nup210l G A 3: 90,172,113 G968D probably damaging Het
Olfr1494 A T 19: 13,749,255 I50F probably benign Het
Olfr697 G T 7: 106,741,765 H56Q probably benign Het
Olfr884 A T 9: 38,048,110 H296L probably benign Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Plcz1 A G 6: 140,007,697 F398S probably damaging Het
Ppfibp2 C A 7: 107,744,177 P808T probably damaging Het
Srpk2 T C 5: 23,527,930 K239E probably damaging Het
Svep1 A G 4: 58,118,232 V830A probably benign Het
Tesc A T 5: 118,056,570 I149F possibly damaging Het
Thsd7a A G 6: 12,418,335 W632R probably damaging Het
Tmprss9 A G 10: 80,894,378 D704G possibly damaging Het
Tob1 T C 11: 94,214,597 Y320H probably damaging Het
Trpm3 G T 19: 22,987,916 D1582Y probably damaging Het
Ttc28 A G 5: 111,277,457 K1716R probably benign Het
Uqcrfs1 A G 13: 30,540,942 V205A probably benign Het
Usp29 G A 7: 6,962,335 M392I probably benign Het
Uspl1 A T 5: 149,188,349 Y22F possibly damaging Het
Vmn1r56 C T 7: 5,196,373 A82T probably benign Het
Vmn2r5 A T 3: 64,492,588 C553S probably damaging Het
Vwce A T 19: 10,664,612 R901W probably damaging Het
Wdpcp C A 11: 21,857,444 probably null Het
Zfp423 A T 8: 87,780,340 C1000* probably null Het
Zscan20 A G 4: 128,585,837 F954L probably benign Het
Other mutations in Virma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Virma APN 4 11519424 splice site probably benign
IGL00477:Virma APN 4 11519006 missense probably damaging 0.99
IGL01293:Virma APN 4 11521114 missense probably damaging 1.00
IGL01410:Virma APN 4 11518929 nonsense probably null
IGL01531:Virma APN 4 11528753 missense probably damaging 1.00
IGL01672:Virma APN 4 11527792 missense probably damaging 1.00
IGL01724:Virma APN 4 11528672 missense probably damaging 1.00
IGL01747:Virma APN 4 11526877 missense probably damaging 1.00
IGL01776:Virma APN 4 11527792 missense probably damaging 1.00
IGL02064:Virma APN 4 11513163 missense possibly damaging 0.87
IGL02243:Virma APN 4 11546031 missense probably damaging 1.00
IGL02244:Virma APN 4 11546031 missense probably damaging 1.00
IGL02445:Virma APN 4 11527029 missense probably damaging 0.97
IGL02546:Virma APN 4 11494804 missense probably damaging 0.99
IGL02807:Virma APN 4 11507079 splice site probably benign
IGL02967:Virma APN 4 11514096 missense probably benign 0.01
IGL03211:Virma APN 4 11548770 nonsense probably null
IGL03242:Virma APN 4 11527669 missense possibly damaging 0.70
IGL03256:Virma APN 4 11542207 splice site probably benign
IGL03327:Virma APN 4 11518984 missense probably benign 0.00
IGL03346:Virma APN 4 11518984 missense probably benign 0.00
PIT4802001:Virma UTSW 4 11546008 missense probably damaging 0.99
R0355:Virma UTSW 4 11528626 nonsense probably null
R0522:Virma UTSW 4 11519416 critical splice donor site probably null
R0600:Virma UTSW 4 11498769 missense probably damaging 0.99
R1435:Virma UTSW 4 11528621 missense probably damaging 1.00
R1489:Virma UTSW 4 11521164 missense probably damaging 1.00
R1568:Virma UTSW 4 11528776 missense probably damaging 0.99
R1616:Virma UTSW 4 11544954 missense probably damaging 1.00
R1655:Virma UTSW 4 11494786 missense probably damaging 1.00
R1695:Virma UTSW 4 11494814 missense probably damaging 0.98
R1835:Virma UTSW 4 11540511 missense probably benign 0.02
R1951:Virma UTSW 4 11513907 missense probably benign 0.00
R1991:Virma UTSW 4 11519242 missense probably benign 0.06
R2145:Virma UTSW 4 11548726 splice site probably benign
R2172:Virma UTSW 4 11527843 missense possibly damaging 0.82
R2217:Virma UTSW 4 11544924 missense probably damaging 1.00
R2218:Virma UTSW 4 11544924 missense probably damaging 1.00
R2248:Virma UTSW 4 11518927 missense probably damaging 1.00
R2342:Virma UTSW 4 11501316 missense probably damaging 1.00
R3424:Virma UTSW 4 11513177 nonsense probably null
R4397:Virma UTSW 4 11513901 missense possibly damaging 0.81
R4449:Virma UTSW 4 11498828 critical splice donor site probably null
R4660:Virma UTSW 4 11513505 missense probably damaging 1.00
R4698:Virma UTSW 4 11528636 missense probably damaging 0.99
R4878:Virma UTSW 4 11544971 missense probably damaging 1.00
R4937:Virma UTSW 4 11521147 nonsense probably null
R5031:Virma UTSW 4 11542116 nonsense probably null
R5040:Virma UTSW 4 11528746 missense probably benign 0.01
R5061:Virma UTSW 4 11494840 missense possibly damaging 0.95
R5091:Virma UTSW 4 11519392 missense probably benign 0.00
R5137:Virma UTSW 4 11546297 missense probably damaging 1.00
R5262:Virma UTSW 4 11539926 missense probably benign 0.01
R5297:Virma UTSW 4 11494819 missense probably damaging 1.00
R5730:Virma UTSW 4 11542154 missense probably benign 0.44
R5818:Virma UTSW 4 11513319 missense possibly damaging 0.92
R5835:Virma UTSW 4 11514036 missense probably damaging 1.00
R6125:Virma UTSW 4 11521172 missense probably damaging 0.98
R6197:Virma UTSW 4 11505498 missense probably damaging 0.96
R6222:Virma UTSW 4 11527820 missense probably damaging 1.00
R6793:Virma UTSW 4 11539968 missense probably damaging 1.00
R7028:Virma UTSW 4 11519249 missense possibly damaging 0.50
R7356:Virma UTSW 4 11513595 missense probably damaging 0.99
R7383:Virma UTSW 4 11514026 missense probably damaging 0.98
R7391:Virma UTSW 4 11508099 missense probably damaging 0.99
R7425:Virma UTSW 4 11546211 missense possibly damaging 0.95
R7556:Virma UTSW 4 11518927 missense probably damaging 1.00
R7715:Virma UTSW 4 11549682 missense probably damaging 1.00
R7715:Virma UTSW 4 11513016 splice site probably null
R7986:Virma UTSW 4 11540023 missense probably benign 0.01
R7990:Virma UTSW 4 11513983 missense probably benign 0.00
R8048:Virma UTSW 4 11539918 nonsense probably null
R8050:Virma UTSW 4 11528643 missense probably benign 0.22
X0020:Virma UTSW 4 11486055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCACTGTGATGCTGCTCAGG -3'
(R):5'- CACTGGCAGTTAAGTTCCAGTCCC -3'

Sequencing Primer
(F):5'- aggagttggaaggcagaaag -3'
(R):5'- TAAGTTCCAGTCCCTGATATGAACC -3'
Posted On2013-04-16