Incidental Mutation 'R1992:Espn'
ID223590
Institutional Source Beutler Lab
Gene Symbol Espn
Ensembl Gene ENSMUSG00000028943
Gene Nameespin
Synonyms
MMRRC Submission 040003-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R1992 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152120331-152152371 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 152128555 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030785] [ENSMUST00000049305] [ENSMUST00000070018] [ENSMUST00000070018] [ENSMUST00000080042] [ENSMUST00000080042] [ENSMUST00000084114] [ENSMUST00000084114] [ENSMUST00000103196] [ENSMUST00000103196] [ENSMUST00000105653] [ENSMUST00000105653] [ENSMUST00000105654] [ENSMUST00000105654] [ENSMUST00000105655] [ENSMUST00000105655] [ENSMUST00000105656] [ENSMUST00000105656] [ENSMUST00000105657] [ENSMUST00000105657] [ENSMUST00000105658] [ENSMUST00000105658] [ENSMUST00000105659] [ENSMUST00000105659] [ENSMUST00000135185] [ENSMUST00000135185] [ENSMUST00000207676] [ENSMUST00000207676]
Predicted Effect probably null
Transcript: ENSMUST00000030785
SMART Domains Protein: ENSMUSP00000030785
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 605 629 N/A INTRINSIC
WH2 669 686 4.82e-3 SMART
low complexity region 714 728 N/A INTRINSIC
low complexity region 740 748 N/A INTRINSIC
coiled coil region 772 848 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000049305
SMART Domains Protein: ENSMUSP00000037982
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
WH2 26 43 4.82e-3 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 122 130 N/A INTRINSIC
coiled coil region 154 230 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070018
SMART Domains Protein: ENSMUSP00000065545
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
WH2 322 339 4.82e-3 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 393 401 N/A INTRINSIC
SCOP:d1eq1a_ 432 499 4e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000070018
SMART Domains Protein: ENSMUSP00000065545
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
WH2 322 339 4.82e-3 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 393 401 N/A INTRINSIC
SCOP:d1eq1a_ 432 499 4e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080042
SMART Domains Protein: ENSMUSP00000078951
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
WH2 250 267 4.82e-3 SMART
low complexity region 295 309 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
SCOP:d1eq1a_ 360 427 2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080042
SMART Domains Protein: ENSMUSP00000078951
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
WH2 250 267 4.82e-3 SMART
low complexity region 295 309 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
SCOP:d1eq1a_ 360 427 2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084114
SMART Domains Protein: ENSMUSP00000081131
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
WH2 331 348 4.82e-3 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 402 410 N/A INTRINSIC
SCOP:d1eq1a_ 441 508 6e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084114
SMART Domains Protein: ENSMUSP00000081131
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
WH2 331 348 4.82e-3 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 402 410 N/A INTRINSIC
SCOP:d1eq1a_ 441 508 6e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103196
SMART Domains Protein: ENSMUSP00000099485
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
WH2 238 255 4.82e-3 SMART
low complexity region 283 297 N/A INTRINSIC
low complexity region 309 317 N/A INTRINSIC
SCOP:d1eq1a_ 348 415 2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103196
SMART Domains Protein: ENSMUSP00000099485
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
WH2 238 255 4.82e-3 SMART
low complexity region 283 297 N/A INTRINSIC
low complexity region 309 317 N/A INTRINSIC
SCOP:d1eq1a_ 348 415 2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105653
SMART Domains Protein: ENSMUSP00000101278
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 28 52 N/A INTRINSIC
low complexity region 65 74 N/A INTRINSIC
WH2 83 100 4.82e-3 SMART
low complexity region 128 142 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
coiled coil region 186 262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105653
SMART Domains Protein: ENSMUSP00000101278
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 28 52 N/A INTRINSIC
low complexity region 65 74 N/A INTRINSIC
WH2 83 100 4.82e-3 SMART
low complexity region 128 142 N/A INTRINSIC
low complexity region 154 162 N/A INTRINSIC
coiled coil region 186 262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105654
SMART Domains Protein: ENSMUSP00000101279
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
low complexity region 301 310 N/A INTRINSIC
WH2 319 336 4.82e-3 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 390 398 N/A INTRINSIC
SCOP:d1eq1a_ 429 496 6e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105654
SMART Domains Protein: ENSMUSP00000101279
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
low complexity region 301 310 N/A INTRINSIC
WH2 319 336 4.82e-3 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 390 398 N/A INTRINSIC
SCOP:d1eq1a_ 429 496 6e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105655
SMART Domains Protein: ENSMUSP00000101280
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
WH2 247 264 4.82e-3 SMART
low complexity region 292 306 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
SCOP:d1eq1a_ 357 424 3e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105655
SMART Domains Protein: ENSMUSP00000101280
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
WH2 247 264 4.82e-3 SMART
low complexity region 292 306 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
SCOP:d1eq1a_ 357 424 3e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105656
SMART Domains Protein: ENSMUSP00000101281
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
WH2 328 345 4.82e-3 SMART
low complexity region 373 387 N/A INTRINSIC
low complexity region 399 407 N/A INTRINSIC
SCOP:d1eq1a_ 438 505 8e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105656
SMART Domains Protein: ENSMUSP00000101281
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
WH2 328 345 4.82e-3 SMART
low complexity region 373 387 N/A INTRINSIC
low complexity region 399 407 N/A INTRINSIC
SCOP:d1eq1a_ 438 505 8e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105657
SMART Domains Protein: ENSMUSP00000101282
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
WH2 241 258 4.82e-3 SMART
low complexity region 286 300 N/A INTRINSIC
low complexity region 312 320 N/A INTRINSIC
SCOP:d1eq1a_ 351 418 2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105657
SMART Domains Protein: ENSMUSP00000101282
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
WH2 241 258 4.82e-3 SMART
low complexity region 286 300 N/A INTRINSIC
low complexity region 312 320 N/A INTRINSIC
SCOP:d1eq1a_ 351 418 2e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105658
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105658
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105659
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105659
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135185
SMART Domains Protein: ENSMUSP00000122464
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 5 35 2.58e-3 SMART
ANK 39 69 1.63e0 SMART
ANK 73 103 4.97e-5 SMART
ANK 107 137 3.08e-1 SMART
ANK 141 170 9.13e-4 SMART
ANK 173 202 2.15e0 SMART
ANK 206 236 2.08e3 SMART
low complexity region 279 297 N/A INTRINSIC
low complexity region 330 367 N/A INTRINSIC
low complexity region 496 520 N/A INTRINSIC
low complexity region 533 542 N/A INTRINSIC
WH2 551 568 4.82e-3 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
coiled coil region 654 685 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135185
SMART Domains Protein: ENSMUSP00000122464
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
ANK 5 35 2.58e-3 SMART
ANK 39 69 1.63e0 SMART
ANK 73 103 4.97e-5 SMART
ANK 107 137 3.08e-1 SMART
ANK 141 170 9.13e-4 SMART
ANK 173 202 2.15e0 SMART
ANK 206 236 2.08e3 SMART
low complexity region 279 297 N/A INTRINSIC
low complexity region 330 367 N/A INTRINSIC
low complexity region 496 520 N/A INTRINSIC
low complexity region 533 542 N/A INTRINSIC
WH2 551 568 4.82e-3 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
coiled coil region 654 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156517
Predicted Effect probably null
Transcript: ENSMUST00000207676
Predicted Effect probably null
Transcript: ENSMUST00000207676
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional actin-bundling protein. It plays a major role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Mutations in this gene are associated with autosomal recessive neurosensory deafness, and autosomal dominant sensorineural deafness without vestibular involvement. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive degeneration of both inner and outer hair cells, severe deafness, vestibular dysfunction, and poor mothering ability. Heterozygotes show a progressive, age-related hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 123 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,338,206 D89G probably damaging Het
1600015I10Rik T A 6: 48,930,769 H234Q probably damaging Het
2310009B15Rik T C 1: 138,853,642 T90A probably damaging Het
4430402I18Rik A G 19: 28,948,624 F130L probably damaging Het
4932438A13Rik A T 3: 37,000,032 H3100L probably benign Het
A930011G23Rik T C 5: 99,233,925 D326G possibly damaging Het
Abcc2 A T 19: 43,807,142 I446F probably damaging Het
Adamts14 A G 10: 61,198,660 Y1150H probably benign Het
Adgrl2 A G 3: 148,817,244 I217T possibly damaging Het
Afap1l1 A T 18: 61,741,771 Y446* probably null Het
Aimp2 G A 5: 143,906,730 A14V probably damaging Het
Akap8 G A 17: 32,316,612 H143Y probably damaging Het
Aldh2 A T 5: 121,575,963 V207E possibly damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Arpp21 T C 9: 112,157,793 E230G probably damaging Het
Arrdc3 G A 13: 80,883,689 D14N probably damaging Het
Atn1 A G 6: 124,745,328 probably benign Het
Atxn7l1 G A 12: 33,358,744 D302N probably damaging Het
Bbs1 T A 19: 4,891,708 H518L probably benign Het
Bmpr1a C A 14: 34,425,093 G241C probably damaging Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Calcrl T C 2: 84,370,511 Y63C probably damaging Het
Cand2 A G 6: 115,785,132 H173R possibly damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Card14 A T 11: 119,321,821 probably null Het
Cd3d T A 9: 44,985,001 Y29* probably null Het
Cd4 A G 6: 124,867,688 V378A possibly damaging Het
Cluh A T 11: 74,660,002 H318L probably damaging Het
Clvs1 T A 4: 9,281,899 D114E probably benign Het
Cnot4 T A 6: 35,023,409 T548S probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crebbp A T 16: 4,128,697 probably null Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dnah7a T G 1: 53,582,676 K1097Q possibly damaging Het
Doc2a T A 7: 126,851,807 probably null Het
Dpp10 A T 1: 123,905,106 V48E probably null Het
Dsg2 A G 18: 20,601,473 K836R probably damaging Het
Egr2 T C 10: 67,540,027 V164A probably damaging Het
Erbin A T 13: 103,833,713 S1132T probably benign Het
Fam83b A G 9: 76,492,022 S600P probably benign Het
Fanca A T 8: 123,297,812 N425K possibly damaging Het
Flot2 C T 11: 78,058,619 L294F probably damaging Het
Frs2 A G 10: 117,074,554 V301A probably benign Het
Fv1 T A 4: 147,869,161 N61K possibly damaging Het
Fxr2 A G 11: 69,649,833 E339G possibly damaging Het
Gck T C 11: 5,906,515 Y214C probably damaging Het
Gm4858 G T 3: 93,074,037 A121S probably benign Het
Gm5346 T C 8: 43,627,139 K16R probably benign Het
Gm9573 A T 17: 35,618,708 S1529T probably benign Het
Golga3 C G 5: 110,192,973 T551R probably damaging Het
Gorab A G 1: 163,397,056 S59P probably damaging Het
Gsdme C T 6: 50,208,122 V451M probably damaging Het
H2-Bl A C 17: 36,081,046 I216S probably damaging Het
Herc4 T A 10: 63,245,964 V22E possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hoxa2 A T 6: 52,164,596 S17T probably damaging Het
Hs3st5 A G 10: 36,832,886 Y139C probably damaging Het
Ism1 G A 2: 139,746,017 V221I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Kdm4c A G 4: 74,343,394 D602G possibly damaging Het
Ktn1 A G 14: 47,695,521 K711E probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Macf1 A G 4: 123,456,695 S3792P probably damaging Het
Maml3 C T 3: 51,690,757 M189I probably benign Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mep1a T G 17: 43,502,682 I13L probably benign Het
Mkrn2 G T 6: 115,609,601 C16F probably damaging Het
Mlh1 C T 9: 111,228,563 A727T probably damaging Het
Naa16 T C 14: 79,356,491 Y344C probably damaging Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nlrc4 T A 17: 74,445,633 Y585F probably benign Het
Nrcam A G 12: 44,540,970 K149R probably damaging Het
Nufip1 T A 14: 76,134,847 I467N probably damaging Het
Nup133 A G 8: 123,906,221 I1057T possibly damaging Het
Obscn A T 11: 58,995,827 probably benign Het
Olfr1113 T A 2: 87,213,244 C117* probably null Het
Olfr173 A G 16: 58,796,946 V300A probably benign Het
Olfr177 A C 16: 58,872,511 I213R probably benign Het
Pi4k2a A T 19: 42,115,938 I380F probably damaging Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pik3cg A T 12: 32,204,025 D654E possibly damaging Het
Poli G T 18: 70,508,987 P714Q probably damaging Het
Polr3f A G 2: 144,536,310 N201D probably benign Het
Ptprz1 A T 6: 22,959,748 K81N probably benign Het
Rbm19 T C 5: 120,133,883 probably null Het
Sec24a C T 11: 51,736,363 V241I probably benign Het
Sgk3 A G 1: 9,880,342 T160A possibly damaging Het
Slc1a4 A G 11: 20,304,375 I497T probably benign Het
Slc26a9 A T 1: 131,762,794 D512V probably damaging Het
Slc43a3 C T 2: 84,957,740 R489C probably damaging Het
Slc5a12 T A 2: 110,621,744 F327L probably benign Het
Slitrk3 A G 3: 73,049,771 V556A possibly damaging Het
Spib T C 7: 44,528,857 E180G probably benign Het
Spint2 T A 7: 29,259,408 N128Y probably damaging Het
Spx G A 6: 142,418,519 G102E probably benign Het
Spz1 T A 13: 92,575,658 E103D possibly damaging Het
Sstr2 T C 11: 113,624,669 I138T probably benign Het
Sytl3 T A 17: 6,733,049 I206N possibly damaging Het
Tcaf2 T C 6: 42,629,857 T388A probably benign Het
Thap12 T C 7: 98,716,365 V580A possibly damaging Het
Tlr5 T A 1: 182,974,347 D405E probably damaging Het
Tnxb T C 17: 34,671,904 V407A probably damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim43a T G 9: 88,584,259 L211R probably damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Ttll8 T C 15: 88,914,451 T694A probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Ube3a C T 7: 59,303,787 A823V probably damaging Het
Ubqln5 C A 7: 104,129,534 V28F probably damaging Het
Ulk1 T A 5: 110,787,151 Q972L probably damaging Het
Unc93b1 T C 19: 3,944,062 Y398H probably benign Het
Usp1 A G 4: 98,934,294 D615G probably benign Het
Utp15 A G 13: 98,250,912 C385R probably benign Het
Vmn2r91 T A 17: 18,135,880 V603D probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Yjefn3 A T 8: 69,888,995 probably null Het
Ywhab A T 2: 164,011,887 I95F probably damaging Het
Zfp143 C T 7: 110,061,282 probably benign Het
Zfp607b C G 7: 27,702,524 T135R possibly damaging Het
Zfp970 A G 2: 177,474,870 Q79R possibly damaging Het
Other mutations in Espn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Espn APN 4 152135602 missense probably damaging 1.00
IGL01404:Espn APN 4 152138444 missense probably benign 0.03
IGL01576:Espn APN 4 152123717 missense probably damaging 1.00
R0015:Espn UTSW 4 152139152 missense possibly damaging 0.77
R1475:Espn UTSW 4 152134271 missense probably damaging 1.00
R1773:Espn UTSW 4 152128229 missense probably damaging 1.00
R2014:Espn UTSW 4 152132959 splice site probably null
R2049:Espn UTSW 4 152121257 missense probably damaging 0.99
R2281:Espn UTSW 4 152135545 missense possibly damaging 0.94
R4278:Espn UTSW 4 152134417 missense probably damaging 1.00
R4527:Espn UTSW 4 152135649 missense probably damaging 0.99
R4539:Espn UTSW 4 152134208 nonsense probably null
R4621:Espn UTSW 4 152131252 missense probably damaging 1.00
R4839:Espn UTSW 4 152138504 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4998:Espn UTSW 4 152135583 missense possibly damaging 0.94
R5412:Espn UTSW 4 152128125 missense probably damaging 1.00
R5570:Espn UTSW 4 152123780 missense probably damaging 1.00
R6549:Espn UTSW 4 152131068 start codon destroyed probably null 0.99
R6551:Espn UTSW 4 152128766
R7124:Espn UTSW 4 152131264 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCACACTGCCATTGAGCAG -3'
(R):5'- ATATACCCAGTGAGTAAGACCTGGTC -3'

Sequencing Primer
(F):5'- CAGTAGGGCTGAGCACTG -3'
(R):5'- GTCACCGTGGACTGGGC -3'
Posted On2014-08-25