Incidental Mutation 'R2019:Or4a72'
ID 223592
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 040028-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R2019 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89405737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: V111A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: V111A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099773
AA Change: V111A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: V111A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: V111A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: V111A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,293,899 (GRCm39) F252L possibly damaging Het
Abcc9 G A 6: 142,621,160 (GRCm39) L527F probably damaging Het
Abi3bp A G 16: 56,498,159 (GRCm39) T918A probably damaging Het
Acp3 C T 9: 104,201,901 (GRCm39) G81R probably damaging Het
Acss3 C T 10: 106,772,068 (GRCm39) S669N probably benign Het
Akt1 T C 12: 112,626,059 (GRCm39) N71S probably damaging Het
Amz1 G T 5: 140,737,719 (GRCm39) M326I probably benign Het
Ankrd36 A G 11: 5,639,140 (GRCm39) I1351V probably benign Het
Art2b T C 7: 101,229,194 (GRCm39) D235G probably benign Het
Ccdc141 A C 2: 76,841,909 (GRCm39) I1507M probably damaging Het
Dck A G 5: 88,921,943 (GRCm39) Y135C probably damaging Het
Dmbt1 T G 7: 130,712,718 (GRCm39) I1563S possibly damaging Het
Dnttip2 T C 3: 122,074,393 (GRCm39) V610A possibly damaging Het
Efhb A G 17: 53,708,505 (GRCm39) S722P probably damaging Het
Emx2 A G 19: 59,447,771 (GRCm39) S42G probably benign Het
Ermard C T 17: 15,273,527 (GRCm39) R371C probably damaging Het
Fat1 T G 8: 45,476,783 (GRCm39) I1943S probably damaging Het
Fignl1 T C 11: 11,752,054 (GRCm39) K334E probably damaging Het
Fmn1 A C 2: 113,194,825 (GRCm39) K175T unknown Het
Gm7247 A T 14: 51,602,804 (GRCm39) M47L possibly damaging Het
Gpalpp1 A T 14: 76,348,131 (GRCm39) probably null Het
Hc A C 2: 34,903,540 (GRCm39) F1038C probably damaging Het
Ifngr1 A T 10: 19,467,861 (GRCm39) M10L probably damaging Het
Irx5 T G 8: 93,084,992 (GRCm39) Y61D probably damaging Het
Itgax A G 7: 127,747,698 (GRCm39) H1038R probably benign Het
Jag1 C T 2: 136,926,599 (GRCm39) E982K probably benign Het
Klhdc9 T C 1: 171,186,509 (GRCm39) D309G probably damaging Het
Lamp3 A T 16: 19,519,961 (GRCm39) M74K probably benign Het
Lrpprc A T 17: 85,059,759 (GRCm39) L685Q possibly damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Mgat5b A G 11: 116,838,174 (GRCm39) Y271C probably benign Het
Mtmr6 T C 14: 60,536,441 (GRCm39) M557T probably benign Het
Myo16 T C 8: 10,426,260 (GRCm39) L339P probably benign Het
Neb G T 2: 52,122,288 (GRCm39) Y580* probably null Het
Npat A G 9: 53,473,791 (GRCm39) K528E probably benign Het
Or1j4 A T 2: 36,740,418 (GRCm39) Y120F possibly damaging Het
Or5m3 A T 2: 85,838,567 (GRCm39) Y149F probably damaging Het
Parp8 G A 13: 117,004,968 (GRCm39) probably benign Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Phospho1 G A 11: 95,721,932 (GRCm39) V201M probably damaging Het
Piezo1 A G 8: 123,209,451 (GRCm39) F2371L probably benign Het
Pitpnm1 T C 19: 4,163,641 (GRCm39) S1209P probably damaging Het
Pkd1 T A 17: 24,787,658 (GRCm39) C20* probably null Het
Prdm5 C A 6: 65,808,340 (GRCm39) N95K probably damaging Het
Prkx T C X: 76,809,010 (GRCm39) D270G probably damaging Het
Ptgis A G 2: 167,050,199 (GRCm39) V310A probably damaging Het
Ptgis G A 2: 167,056,730 (GRCm39) Q286* probably null Het
Rpf1 T A 3: 146,226,976 (GRCm39) N59I probably damaging Het
Rpl3l A C 17: 24,954,490 (GRCm39) probably benign Het
Ryr2 C T 13: 11,866,074 (GRCm39) G292D possibly damaging Het
Ryr3 G T 2: 112,611,410 (GRCm39) N2257K probably benign Het
Sla T C 15: 66,654,404 (GRCm39) Y278C probably damaging Het
Slc4a10 A T 2: 62,064,725 (GRCm39) D193V probably damaging Het
Spire2 T C 8: 124,059,657 (GRCm39) C52R probably damaging Het
Tada2b T C 5: 36,641,250 (GRCm39) Y51C probably damaging Het
Tarbp1 C T 8: 127,154,853 (GRCm39) V1424I probably damaging Het
Tbpl1 T A 10: 22,583,576 (GRCm39) E131D probably damaging Het
Tgfbrap1 A G 1: 43,093,677 (GRCm39) probably null Het
Tmem116 A G 5: 121,627,317 (GRCm39) I151M possibly damaging Het
Tmem30a T C 9: 79,681,500 (GRCm39) D223G probably damaging Het
Trim13 T A 14: 61,842,335 (GRCm39) C117* probably null Het
Ttn C G 2: 76,585,676 (GRCm39) D21987H probably damaging Het
Txnrd1 G A 10: 82,713,207 (GRCm39) V90I probably benign Het
Unc79 G A 12: 103,137,830 (GRCm39) probably null Het
Upp1 A T 11: 9,083,240 (GRCm39) M111L possibly damaging Het
Vmn2r79 G T 7: 86,651,634 (GRCm39) L344F probably benign Het
Vps39 T C 2: 120,173,708 (GRCm39) Y147C probably damaging Het
Wdr59 A G 8: 112,193,425 (GRCm39) Y666H probably damaging Het
Wdr95 A G 5: 149,497,613 (GRCm39) probably benign Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGTGCATGCAAGTACC -3'
(R):5'- TGGTGACAGTCATTACCAGC -3'

Sequencing Primer
(F):5'- GTCTGTGCATGCAAGTACCAATAATG -3'
(R):5'- GTGACAGTCATTACCAGCCCCTC -3'
Posted On 2014-08-25