Incidental Mutation 'R2019:Ptgis'
ID223604
Institutional Source Beutler Lab
Gene Symbol Ptgis
Ensembl Gene ENSMUSG00000017969
Gene Nameprostaglandin I2 (prostacyclin) synthase
SynonymsCyp8a1, Pgis, Pgi2
MMRRC Submission 040028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2019 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167191805-167240604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167208279 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 310 (V310A)
Ref Sequence ENSEMBL: ENSMUSP00000085357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018113] [ENSMUST00000088041]
Predicted Effect probably damaging
Transcript: ENSMUST00000018113
AA Change: V310A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018113
Gene: ENSMUSG00000017969
AA Change: V310A

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 495 8.6e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088041
AA Change: V310A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085357
Gene: ENSMUSG00000017969
AA Change: V310A

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:p450 31 496 1.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136271
Meta Mutation Damage Score 0.7146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than functional similarity. This endoplasmic reticulum membrane protein catalyzes the conversion of prostglandin H2 to prostacyclin (prostaglandin I2), a potent vasodilator and inhibitor of platelet aggregation. An imbalance of prostacyclin and its physiological antagonist thromboxane A2 contribute to the development of myocardial infarction, stroke, and atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased blood urea nitrogen and creatinine levels, thickening of the aorta with age, mildly increased blood pressure, and kidney abnormalities including cysts, fibrosis, necrosis, and renal vascular congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
Abcc9 G A 6: 142,675,434 L527F probably damaging Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acpp C T 9: 104,324,702 G81R probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amz1 G T 5: 140,751,964 M326I probably benign Het
Ankrd36 A G 11: 5,689,140 I1351V probably benign Het
Art2b T C 7: 101,579,987 D235G probably benign Het
Ccdc141 A C 2: 77,011,565 I1507M probably damaging Het
Dck A G 5: 88,774,084 Y135C probably damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnttip2 T C 3: 122,280,744 V610A possibly damaging Het
Efhb A G 17: 53,401,477 S722P probably damaging Het
Emx2 A G 19: 59,459,339 S42G probably benign Het
Ermard C T 17: 15,053,265 R371C probably damaging Het
Fat1 T G 8: 45,023,746 I1943S probably damaging Het
Fignl1 T C 11: 11,802,054 K334E probably damaging Het
Fmn1 A C 2: 113,364,480 K175T unknown Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gpalpp1 A T 14: 76,110,691 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Ifngr1 A T 10: 19,592,113 M10L probably damaging Het
Irx5 T G 8: 92,358,364 Y61D probably damaging Het
Itgax A G 7: 128,148,526 H1038R probably benign Het
Jag1 C T 2: 137,084,679 E982K probably benign Het
Klhdc9 T C 1: 171,358,941 D309G probably damaging Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Lrpprc A T 17: 84,752,331 L685Q possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Mgat5b A G 11: 116,947,348 Y271C probably benign Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myo16 T C 8: 10,376,260 L339P probably benign Het
Neb G T 2: 52,232,276 Y580* probably null Het
Npat A G 9: 53,562,491 K528E probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr350 A T 2: 36,850,406 Y120F possibly damaging Het
Parp8 G A 13: 116,868,432 probably benign Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Phospho1 G A 11: 95,831,106 V201M probably damaging Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Pitpnm1 T C 19: 4,113,641 S1209P probably damaging Het
Pkd1 T A 17: 24,568,684 C20* probably null Het
Prdm5 C A 6: 65,831,356 N95K probably damaging Het
Prkx T C X: 77,765,404 D270G probably damaging Het
Rpf1 T A 3: 146,521,221 N59I probably damaging Het
Rpl3l A C 17: 24,735,516 probably benign Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Sla T C 15: 66,782,555 Y278C probably damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Tada2b T C 5: 36,483,906 Y51C probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Tgfbrap1 A G 1: 43,054,517 probably null Het
Tmem116 A G 5: 121,489,254 I151M possibly damaging Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Txnrd1 G A 10: 82,877,373 V90I probably benign Het
Unc79 G A 12: 103,171,571 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Wdr59 A G 8: 111,466,793 Y666H probably damaging Het
Wdr95 A G 5: 149,574,148 probably benign Het
Other mutations in Ptgis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Ptgis APN 2 167206830 missense probably damaging 1.00
IGL01859:Ptgis APN 2 167214806 critical splice donor site probably null
IGL01965:Ptgis APN 2 167208253 missense probably benign 0.00
IGL02102:Ptgis APN 2 167225447 missense probably damaging 0.99
IGL02296:Ptgis APN 2 167206737 missense probably damaging 1.00
IGL02434:Ptgis APN 2 167240342 critical splice donor site probably null
PIT4142001:Ptgis UTSW 2 167206830 missense probably damaging 1.00
R0332:Ptgis UTSW 2 167214833 missense probably damaging 0.99
R0614:Ptgis UTSW 2 167206882 missense probably damaging 1.00
R1733:Ptgis UTSW 2 167191968 unclassified probably benign
R1756:Ptgis UTSW 2 167206803 missense probably damaging 1.00
R1779:Ptgis UTSW 2 167214858 missense probably benign 0.01
R2004:Ptgis UTSW 2 167214849 missense possibly damaging 0.94
R2019:Ptgis UTSW 2 167214810 nonsense probably null
R2512:Ptgis UTSW 2 167207276 missense probably damaging 0.99
R2679:Ptgis UTSW 2 167208193 missense probably benign 0.38
R4962:Ptgis UTSW 2 167225274 critical splice donor site probably null
R5174:Ptgis UTSW 2 167203470 critical splice acceptor site probably null
R5471:Ptgis UTSW 2 167224119 missense probably benign 0.03
R5717:Ptgis UTSW 2 167208364 splice site probably benign
R7268:Ptgis UTSW 2 167206756 missense probably benign 0.10
R7513:Ptgis UTSW 2 167225283 missense probably benign 0.00
R7515:Ptgis UTSW 2 167206838 missense possibly damaging 0.91
R7615:Ptgis UTSW 2 167223988 missense probably damaging 1.00
R7736:Ptgis UTSW 2 167191971 missense unknown
R7891:Ptgis UTSW 2 167227514 missense probably damaging 1.00
R7974:Ptgis UTSW 2 167227514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCATGGGGTAGTTGACAC -3'
(R):5'- ACCAGTGATACCTGGGTGTTTG -3'

Sequencing Primer
(F):5'- TTGACACTGGGCATGAAGC -3'
(R):5'- TTTGGTCAGCACGGGAAC -3'
Posted On2014-08-25