Mutagenetix > Incidental Mutations

Incidental Mutation 'R2019:Dnttip2'

223609

Institutional Source

Beutler Lab

Gene Symbol

Dnttip2

Ensembl Gene

ENSMUSG00000039756

Gene Name

deoxynucleotidyltransferase, terminal, interacting protein 2

Synonyms

4930588M11Rik

MMRRC Submission

040028-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R2019 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122274388-122285271 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122280744 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 610 (V610A)

Ref Sequence

ENSEMBL: ENSMUSP00000045043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035776]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035776
AA Change: V610A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: V610A

Domain	Start	End	E-Value	Type
low complexity region	125	143	N/A	INTRINSIC
low complexity region	447	458	N/A	INTRINSIC
coiled coil region	513	541	N/A	INTRINSIC
low complexity region	550	565	N/A	INTRINSIC
Pfam:Fcf2	639	733	3.4e-41	PFAM
low complexity region	748	756	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000072769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196338

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199627

Meta Mutation Damage Score

0.1290

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	C	A	10: 76,458,065	F252L	possibly damaging	Het
Abcc9	G	A	6: 142,675,434	L527F	probably damaging	Het
Abi3bp	A	G	16: 56,677,796	T918A	probably damaging	Het
Acpp	C	T	9: 104,324,702	G81R	probably damaging	Het
Acss3	C	T	10: 106,936,207	S669N	probably benign	Het
Akt1	T	C	12: 112,659,625	N71S	probably damaging	Het
Amz1	G	T	5: 140,751,964	M326I	probably benign	Het
Ankrd36	A	G	11: 5,689,140	I1351V	probably benign	Het
Art2b	T	C	7: 101,579,987	D235G	probably benign	Het
Ccdc141	A	C	2: 77,011,565	I1507M	probably damaging	Het
Dck	A	G	5: 88,774,084	Y135C	probably damaging	Het
Dmbt1	T	G	7: 131,110,989	I1563S	possibly damaging	Het
Efhb	A	G	17: 53,401,477	S722P	probably damaging	Het
Emx2	A	G	19: 59,459,339	S42G	probably benign	Het
Ermard	C	T	17: 15,053,265	R371C	probably damaging	Het
Fat1	T	G	8: 45,023,746	I1943S	probably damaging	Het
Fignl1	T	C	11: 11,802,054	K334E	probably damaging	Het
Fmn1	A	C	2: 113,364,480	K175T	unknown	Het
Gm7247	A	T	14: 51,365,347	M47L	possibly damaging	Het
Gpalpp1	A	T	14: 76,110,691		probably null	Het
Hc	A	C	2: 35,013,528	F1038C	probably damaging	Het
Ifngr1	A	T	10: 19,592,113	M10L	probably damaging	Het
Irx5	T	G	8: 92,358,364	Y61D	probably damaging	Het
Itgax	A	G	7: 128,148,526	H1038R	probably benign	Het
Jag1	C	T	2: 137,084,679	E982K	probably benign	Het
Klhdc9	T	C	1: 171,358,941	D309G	probably damaging	Het
Lamp3	A	T	16: 19,701,211	M74K	probably benign	Het
Lrpprc	A	T	17: 84,752,331	L685Q	possibly damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Mgat5b	A	G	11: 116,947,348	Y271C	probably benign	Het
Mtmr6	T	C	14: 60,298,992	M557T	probably benign	Het
Myo16	T	C	8: 10,376,260	L339P	probably benign	Het
Neb	G	T	2: 52,232,276	Y580*	probably null	Het
Npat	A	G	9: 53,562,491	K528E	probably benign	Het
Olfr1032	A	T	2: 86,008,223	Y149F	probably damaging	Het
Olfr1245	A	G	2: 89,575,393	V111A	probably damaging	Het
Olfr350	A	T	2: 36,850,406	Y120F	possibly damaging	Het
Parp8	G	A	13: 116,868,432		probably benign	Het
Phf3	G	A	1: 30,811,847	T1142M	probably damaging	Het
Phospho1	G	A	11: 95,831,106	V201M	probably damaging	Het
Piezo1	A	G	8: 122,482,712	F2371L	probably benign	Het
Pitpnm1	T	C	19: 4,113,641	S1209P	probably damaging	Het
Pkd1	T	A	17: 24,568,684	C20*	probably null	Het
Prdm5	C	A	6: 65,831,356	N95K	probably damaging	Het
Prkx	T	C	X: 77,765,404	D270G	probably damaging	Het
Ptgis	A	G	2: 167,208,279	V310A	probably damaging	Het
Ptgis	G	A	2: 167,214,810	Q286*	probably null	Het
Rpf1	T	A	3: 146,521,221	N59I	probably damaging	Het
Rpl3l	A	C	17: 24,735,516		probably benign	Het
Ryr2	C	T	13: 11,851,188	G292D	possibly damaging	Het
Ryr3	G	T	2: 112,781,065	N2257K	probably benign	Het
Sla	T	C	15: 66,782,555	Y278C	probably damaging	Het
Slc4a10	A	T	2: 62,234,381	D193V	probably damaging	Het
Spire2	T	C	8: 123,332,918	C52R	probably damaging	Het
Tada2b	T	C	5: 36,483,906	Y51C	probably damaging	Het
Tarbp1	C	T	8: 126,428,114	V1424I	probably damaging	Het
Tbpl1	T	A	10: 22,707,677	E131D	probably damaging	Het
Tgfbrap1	A	G	1: 43,054,517		probably null	Het
Tmem116	A	G	5: 121,489,254	I151M	possibly damaging	Het
Tmem30a	T	C	9: 79,774,218	D223G	probably damaging	Het
Trim13	T	A	14: 61,604,886	C117*	probably null	Het
Ttn	C	G	2: 76,755,332	D21987H	probably damaging	Het
Txnrd1	G	A	10: 82,877,373	V90I	probably benign	Het
Unc79	G	A	12: 103,171,571		probably null	Het
Upp1	A	T	11: 9,133,240	M111L	possibly damaging	Het
Vmn2r79	G	T	7: 87,002,426	L344F	probably benign	Het
Vps39	T	C	2: 120,343,227	Y147C	probably damaging	Het
Wdr59	A	G	8: 111,466,793	Y666H	probably damaging	Het
Wdr95	A	G	5: 149,574,148		probably benign	Het

Other mutations in Dnttip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Dnttip2	APN	3	122284499	missense	probably damaging	1.00
IGL00921:Dnttip2	APN	3	122275290	missense	probably benign	0.03
IGL01120:Dnttip2	APN	3	122278737	splice site	probably benign
IGL01341:Dnttip2	APN	3	122276612	missense	probably damaging	1.00
IGL01636:Dnttip2	APN	3	122282474	missense	possibly damaging	0.95
IGL01988:Dnttip2	APN	3	122276295	missense	probably benign	0.05
IGL02096:Dnttip2	APN	3	122284413	missense	possibly damaging	0.51
IGL02216:Dnttip2	APN	3	122276261	missense	probably benign	0.01
IGL03234:Dnttip2	APN	3	122282438	missense	probably damaging	1.00
Abyss	UTSW	3	122276221	missense	probably damaging	0.99
Chasm	UTSW	3	122275808	missense	probably damaging	1.00
R0089:Dnttip2	UTSW	3	122275462	missense	possibly damaging	0.59
R0102:Dnttip2	UTSW	3	122275803	missense	probably benign	0.00
R0102:Dnttip2	UTSW	3	122275803	missense	probably benign	0.00
R0195:Dnttip2	UTSW	3	122276161	missense	probably benign	0.02
R1103:Dnttip2	UTSW	3	122276422	missense	probably benign	0.02
R1733:Dnttip2	UTSW	3	122276748	missense	probably benign	0.25
R1759:Dnttip2	UTSW	3	122276149	missense	probably benign	0.21
R2022:Dnttip2	UTSW	3	122276221	missense	probably damaging	1.00
R2415:Dnttip2	UTSW	3	122276537	missense	probably damaging	1.00
R3913:Dnttip2	UTSW	3	122275391	missense	possibly damaging	0.68
R4194:Dnttip2	UTSW	3	122280761	missense	probably damaging	1.00
R4367:Dnttip2	UTSW	3	122276497	missense	probably damaging	1.00
R4871:Dnttip2	UTSW	3	122285101	missense	probably damaging	1.00
R4888:Dnttip2	UTSW	3	122276592	missense	probably damaging	1.00
R5082:Dnttip2	UTSW	3	122275941	missense	probably damaging	0.98
R5436:Dnttip2	UTSW	3	122278769	missense	probably damaging	1.00
R5483:Dnttip2	UTSW	3	122276797	missense	probably damaging	0.97
R5933:Dnttip2	UTSW	3	122275568	missense	probably benign	0.07
R5966:Dnttip2	UTSW	3	122285168	utr 3 prime	probably benign
R6171:Dnttip2	UTSW	3	122278862	missense	probably damaging	0.99
R6251:Dnttip2	UTSW	3	122275256	missense	probably benign	0.14
R6286:Dnttip2	UTSW	3	122284400	missense	probably damaging	1.00
R6512:Dnttip2	UTSW	3	122275523	missense	possibly damaging	0.67
R6519:Dnttip2	UTSW	3	122275471	missense	probably benign	0.05
R6670:Dnttip2	UTSW	3	122276221	missense	probably damaging	0.99
R6833:Dnttip2	UTSW	3	122276803	missense	probably damaging	0.99
R6870:Dnttip2	UTSW	3	122275808	missense	probably damaging	1.00
R6969:Dnttip2	UTSW	3	122282492	missense	probably damaging	1.00
R7038:Dnttip2	UTSW	3	122276532	nonsense	probably null
R7233:Dnttip2	UTSW	3	122276390	missense	probably benign	0.26
R7423:Dnttip2	UTSW	3	122275526	missense	probably benign
R7591:Dnttip2	UTSW	3	122276468	nonsense	probably null
R7765:Dnttip2	UTSW	3	122275945	missense	probably benign	0.09
R7842:Dnttip2	UTSW	3	122276341	missense	probably benign	0.03
R7899:Dnttip2	UTSW	3	122282369	missense	probably damaging	1.00
R8408:Dnttip2	UTSW	3	122276702	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGATAGACTAGTGGATTTGCC -3'
(R):5'- TTGGCCCAACCTAGAATAGACC -3'

Sequencing Primer
(F):5'- GTAAAAGCCTAAGGTTATCTCTCTCC -3'
(R):5'- GGCCCAACCTAGAATAGACCAATCC -3'

Posted On

2014-08-25