Incidental Mutation 'R2019:Amz1'
ID 223617
Institutional Source Beutler Lab
Gene Symbol Amz1
Ensembl Gene ENSMUSG00000050022
Gene Name archaelysin family metallopeptidase 1
Synonyms 6530401C20Rik
MMRRC Submission 040028-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.052) question?
Stock # R2019 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 140709882-140739067 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 140737719 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 326 (M326I)
Ref Sequence ENSEMBL: ENSMUSP00000113911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060918] [ENSMUST00000120630]
AlphaFold Q8BVF9
Predicted Effect probably benign
Transcript: ENSMUST00000060918
AA Change: M326I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053110
Gene: ENSMUSG00000050022
AA Change: M326I

DomainStartEndE-ValueType
low complexity region 225 239 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120630
AA Change: M326I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113911
Gene: ENSMUSG00000050022
AA Change: M326I

DomainStartEndE-ValueType
low complexity region 225 239 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155644
Predicted Effect unknown
Transcript: ENSMUST00000176035
AA Change: M25I
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,293,899 (GRCm39) F252L possibly damaging Het
Abcc9 G A 6: 142,621,160 (GRCm39) L527F probably damaging Het
Abi3bp A G 16: 56,498,159 (GRCm39) T918A probably damaging Het
Acp3 C T 9: 104,201,901 (GRCm39) G81R probably damaging Het
Acss3 C T 10: 106,772,068 (GRCm39) S669N probably benign Het
Akt1 T C 12: 112,626,059 (GRCm39) N71S probably damaging Het
Ankrd36 A G 11: 5,639,140 (GRCm39) I1351V probably benign Het
Art2b T C 7: 101,229,194 (GRCm39) D235G probably benign Het
Ccdc141 A C 2: 76,841,909 (GRCm39) I1507M probably damaging Het
Dck A G 5: 88,921,943 (GRCm39) Y135C probably damaging Het
Dmbt1 T G 7: 130,712,718 (GRCm39) I1563S possibly damaging Het
Dnttip2 T C 3: 122,074,393 (GRCm39) V610A possibly damaging Het
Efhb A G 17: 53,708,505 (GRCm39) S722P probably damaging Het
Emx2 A G 19: 59,447,771 (GRCm39) S42G probably benign Het
Ermard C T 17: 15,273,527 (GRCm39) R371C probably damaging Het
Fat1 T G 8: 45,476,783 (GRCm39) I1943S probably damaging Het
Fignl1 T C 11: 11,752,054 (GRCm39) K334E probably damaging Het
Fmn1 A C 2: 113,194,825 (GRCm39) K175T unknown Het
Gm7247 A T 14: 51,602,804 (GRCm39) M47L possibly damaging Het
Gpalpp1 A T 14: 76,348,131 (GRCm39) probably null Het
Hc A C 2: 34,903,540 (GRCm39) F1038C probably damaging Het
Ifngr1 A T 10: 19,467,861 (GRCm39) M10L probably damaging Het
Irx5 T G 8: 93,084,992 (GRCm39) Y61D probably damaging Het
Itgax A G 7: 127,747,698 (GRCm39) H1038R probably benign Het
Jag1 C T 2: 136,926,599 (GRCm39) E982K probably benign Het
Klhdc9 T C 1: 171,186,509 (GRCm39) D309G probably damaging Het
Lamp3 A T 16: 19,519,961 (GRCm39) M74K probably benign Het
Lrpprc A T 17: 85,059,759 (GRCm39) L685Q possibly damaging Het
Magel2 G A 7: 62,028,844 (GRCm39) V583I unknown Het
Mgat5b A G 11: 116,838,174 (GRCm39) Y271C probably benign Het
Mtmr6 T C 14: 60,536,441 (GRCm39) M557T probably benign Het
Myo16 T C 8: 10,426,260 (GRCm39) L339P probably benign Het
Neb G T 2: 52,122,288 (GRCm39) Y580* probably null Het
Npat A G 9: 53,473,791 (GRCm39) K528E probably benign Het
Or1j4 A T 2: 36,740,418 (GRCm39) Y120F possibly damaging Het
Or4a72 A G 2: 89,405,737 (GRCm39) V111A probably damaging Het
Or5m3 A T 2: 85,838,567 (GRCm39) Y149F probably damaging Het
Parp8 G A 13: 117,004,968 (GRCm39) probably benign Het
Phf3 G A 1: 30,850,928 (GRCm39) T1142M probably damaging Het
Phospho1 G A 11: 95,721,932 (GRCm39) V201M probably damaging Het
Piezo1 A G 8: 123,209,451 (GRCm39) F2371L probably benign Het
Pitpnm1 T C 19: 4,163,641 (GRCm39) S1209P probably damaging Het
Pkd1 T A 17: 24,787,658 (GRCm39) C20* probably null Het
Prdm5 C A 6: 65,808,340 (GRCm39) N95K probably damaging Het
Prkx T C X: 76,809,010 (GRCm39) D270G probably damaging Het
Ptgis A G 2: 167,050,199 (GRCm39) V310A probably damaging Het
Ptgis G A 2: 167,056,730 (GRCm39) Q286* probably null Het
Rpf1 T A 3: 146,226,976 (GRCm39) N59I probably damaging Het
Rpl3l A C 17: 24,954,490 (GRCm39) probably benign Het
Ryr2 C T 13: 11,866,074 (GRCm39) G292D possibly damaging Het
Ryr3 G T 2: 112,611,410 (GRCm39) N2257K probably benign Het
Sla T C 15: 66,654,404 (GRCm39) Y278C probably damaging Het
Slc4a10 A T 2: 62,064,725 (GRCm39) D193V probably damaging Het
Spire2 T C 8: 124,059,657 (GRCm39) C52R probably damaging Het
Tada2b T C 5: 36,641,250 (GRCm39) Y51C probably damaging Het
Tarbp1 C T 8: 127,154,853 (GRCm39) V1424I probably damaging Het
Tbpl1 T A 10: 22,583,576 (GRCm39) E131D probably damaging Het
Tgfbrap1 A G 1: 43,093,677 (GRCm39) probably null Het
Tmem116 A G 5: 121,627,317 (GRCm39) I151M possibly damaging Het
Tmem30a T C 9: 79,681,500 (GRCm39) D223G probably damaging Het
Trim13 T A 14: 61,842,335 (GRCm39) C117* probably null Het
Ttn C G 2: 76,585,676 (GRCm39) D21987H probably damaging Het
Txnrd1 G A 10: 82,713,207 (GRCm39) V90I probably benign Het
Unc79 G A 12: 103,137,830 (GRCm39) probably null Het
Upp1 A T 11: 9,083,240 (GRCm39) M111L possibly damaging Het
Vmn2r79 G T 7: 86,651,634 (GRCm39) L344F probably benign Het
Vps39 T C 2: 120,173,708 (GRCm39) Y147C probably damaging Het
Wdr59 A G 8: 112,193,425 (GRCm39) Y666H probably damaging Het
Wdr95 A G 5: 149,497,613 (GRCm39) probably benign Het
Other mutations in Amz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Amz1 APN 5 140,727,034 (GRCm39) utr 5 prime probably benign
IGL02340:Amz1 APN 5 140,738,014 (GRCm39) missense probably damaging 1.00
IGL03389:Amz1 APN 5 140,737,782 (GRCm39) missense probably benign
PIT4131001:Amz1 UTSW 5 140,735,088 (GRCm39) critical splice donor site probably null
R1173:Amz1 UTSW 5 140,737,691 (GRCm39) critical splice acceptor site probably null
R1237:Amz1 UTSW 5 140,727,039 (GRCm39) start codon destroyed probably damaging 0.98
R1435:Amz1 UTSW 5 140,733,921 (GRCm39) missense probably damaging 1.00
R1909:Amz1 UTSW 5 140,738,216 (GRCm39) missense probably benign 0.30
R4094:Amz1 UTSW 5 140,737,921 (GRCm39) missense probably damaging 0.99
R4374:Amz1 UTSW 5 140,738,194 (GRCm39) missense possibly damaging 0.83
R5121:Amz1 UTSW 5 140,729,919 (GRCm39) missense probably benign 0.05
R5462:Amz1 UTSW 5 140,733,976 (GRCm39) missense probably damaging 1.00
R7339:Amz1 UTSW 5 140,727,306 (GRCm39) missense probably benign 0.01
R7475:Amz1 UTSW 5 140,729,941 (GRCm39) critical splice donor site probably null
R7915:Amz1 UTSW 5 140,727,190 (GRCm39) missense probably benign
R8416:Amz1 UTSW 5 140,737,731 (GRCm39) nonsense probably null
R8539:Amz1 UTSW 5 140,734,412 (GRCm39) missense probably benign 0.05
R8766:Amz1 UTSW 5 140,733,921 (GRCm39) missense probably benign 0.01
R9500:Amz1 UTSW 5 140,737,975 (GRCm39) missense probably benign 0.00
R9563:Amz1 UTSW 5 140,738,133 (GRCm39) missense probably damaging 1.00
R9707:Amz1 UTSW 5 140,733,949 (GRCm39) missense possibly damaging 0.63
Z1176:Amz1 UTSW 5 140,729,828 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTTAACAGCCATCTTGCC -3'
(R):5'- CAGATACTGGTTCAGGTCCGTC -3'

Sequencing Primer
(F):5'- CCATCTTGCCAAGTACGTGTGAAAG -3'
(R):5'- TCAGGGAAGGGATGACTCCAC -3'
Posted On 2014-08-25