Incidental Mutation 'R2019:Magel2'
ID223625
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Namemelanoma antigen, family L, 2
SynonymsnM15, ns7, NDNL1, Mage-l2
MMRRC Submission 040028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2019 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location62377010-62381640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62379096 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 583 (V583I)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
Predicted Effect unknown
Transcript: ENSMUST00000080403
AA Change: V583I
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: V583I

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C A 10: 76,458,065 F252L possibly damaging Het
Abcc9 G A 6: 142,675,434 L527F probably damaging Het
Abi3bp A G 16: 56,677,796 T918A probably damaging Het
Acpp C T 9: 104,324,702 G81R probably damaging Het
Acss3 C T 10: 106,936,207 S669N probably benign Het
Akt1 T C 12: 112,659,625 N71S probably damaging Het
Amz1 G T 5: 140,751,964 M326I probably benign Het
Ankrd36 A G 11: 5,689,140 I1351V probably benign Het
Art2b T C 7: 101,579,987 D235G probably benign Het
Ccdc141 A C 2: 77,011,565 I1507M probably damaging Het
Dck A G 5: 88,774,084 Y135C probably damaging Het
Dmbt1 T G 7: 131,110,989 I1563S possibly damaging Het
Dnttip2 T C 3: 122,280,744 V610A possibly damaging Het
Efhb A G 17: 53,401,477 S722P probably damaging Het
Emx2 A G 19: 59,459,339 S42G probably benign Het
Ermard C T 17: 15,053,265 R371C probably damaging Het
Fat1 T G 8: 45,023,746 I1943S probably damaging Het
Fignl1 T C 11: 11,802,054 K334E probably damaging Het
Fmn1 A C 2: 113,364,480 K175T unknown Het
Gm7247 A T 14: 51,365,347 M47L possibly damaging Het
Gpalpp1 A T 14: 76,110,691 probably null Het
Hc A C 2: 35,013,528 F1038C probably damaging Het
Ifngr1 A T 10: 19,592,113 M10L probably damaging Het
Irx5 T G 8: 92,358,364 Y61D probably damaging Het
Itgax A G 7: 128,148,526 H1038R probably benign Het
Jag1 C T 2: 137,084,679 E982K probably benign Het
Klhdc9 T C 1: 171,358,941 D309G probably damaging Het
Lamp3 A T 16: 19,701,211 M74K probably benign Het
Lrpprc A T 17: 84,752,331 L685Q possibly damaging Het
Mgat5b A G 11: 116,947,348 Y271C probably benign Het
Mtmr6 T C 14: 60,298,992 M557T probably benign Het
Myo16 T C 8: 10,376,260 L339P probably benign Het
Neb G T 2: 52,232,276 Y580* probably null Het
Npat A G 9: 53,562,491 K528E probably benign Het
Olfr1032 A T 2: 86,008,223 Y149F probably damaging Het
Olfr1245 A G 2: 89,575,393 V111A probably damaging Het
Olfr350 A T 2: 36,850,406 Y120F possibly damaging Het
Parp8 G A 13: 116,868,432 probably benign Het
Phf3 G A 1: 30,811,847 T1142M probably damaging Het
Phospho1 G A 11: 95,831,106 V201M probably damaging Het
Piezo1 A G 8: 122,482,712 F2371L probably benign Het
Pitpnm1 T C 19: 4,113,641 S1209P probably damaging Het
Pkd1 T A 17: 24,568,684 C20* probably null Het
Prdm5 C A 6: 65,831,356 N95K probably damaging Het
Prkx T C X: 77,765,404 D270G probably damaging Het
Ptgis A G 2: 167,208,279 V310A probably damaging Het
Ptgis G A 2: 167,214,810 Q286* probably null Het
Rpf1 T A 3: 146,521,221 N59I probably damaging Het
Rpl3l A C 17: 24,735,516 probably benign Het
Ryr2 C T 13: 11,851,188 G292D possibly damaging Het
Ryr3 G T 2: 112,781,065 N2257K probably benign Het
Sla T C 15: 66,782,555 Y278C probably damaging Het
Slc4a10 A T 2: 62,234,381 D193V probably damaging Het
Spire2 T C 8: 123,332,918 C52R probably damaging Het
Tada2b T C 5: 36,483,906 Y51C probably damaging Het
Tarbp1 C T 8: 126,428,114 V1424I probably damaging Het
Tbpl1 T A 10: 22,707,677 E131D probably damaging Het
Tgfbrap1 A G 1: 43,054,517 probably null Het
Tmem116 A G 5: 121,489,254 I151M possibly damaging Het
Tmem30a T C 9: 79,774,218 D223G probably damaging Het
Trim13 T A 14: 61,604,886 C117* probably null Het
Ttn C G 2: 76,755,332 D21987H probably damaging Het
Txnrd1 G A 10: 82,877,373 V90I probably benign Het
Unc79 G A 12: 103,171,571 probably null Het
Upp1 A T 11: 9,133,240 M111L possibly damaging Het
Vmn2r79 G T 7: 87,002,426 L344F probably benign Het
Vps39 T C 2: 120,343,227 Y147C probably damaging Het
Wdr59 A G 8: 111,466,793 Y666H probably damaging Het
Wdr95 A G 5: 149,574,148 probably benign Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2131:Magel2 UTSW 7 62377738 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4621:Magel2 UTSW 7 62377738 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5769:Magel2 UTSW 7 62378113 missense probably benign 0.02
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6187:Magel2 UTSW 7 62377641 missense unknown
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7011:Magel2 UTSW 7 62378533 missense possibly damaging 0.92
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
R7714:Magel2 UTSW 7 62378382 missense probably benign 0.08
R7836:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
R8289:Magel2 UTSW 7 62379127 missense unknown
RF022:Magel2 UTSW 7 62380093 missense unknown
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Z1177:Magel2 UTSW 7 62379607 missense unknown
Predicted Primers PCR Primer
(F):5'- GATACATTTGGTGCCACAGTCAG -3'
(R):5'- TCCTGGAACTCCAATGGCAC -3'

Sequencing Primer
(F):5'- AGGTGCCCCAGACAGTACTG -3'
(R):5'- AACTCCAATGGCACCGGGAG -3'
Posted On2014-08-25